Search Results

Search found 11438 results on 458 pages for 'self imposed homework'.

Page 70/458 | < Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >

  • Enumeration trouble: redeclared as different kind of symbol

    - by Matt
    Hello all. I am writing a program that is supposed to help me learn about enumeration data types in C++. The current trouble is that the compiler doesn't like my enum usage when trying to use the new data type as I would other data types. I am getting the error "redeclared as different kind of symbol" when compiling my trangleShape function. Take a look at the relevant code. Any insight is appreciated! Thanks! (All functions are their own .cpp files.) header file #ifndef HEADER_H_INCLUDED #define HEADER_H_INCLUDED #include <iostream> #include <iomanip> using namespace std; enum triangleType {noTriangle, scalene, isoceles, equilateral}; //prototypes void extern input(float&, float&, float&); triangleType extern triangleShape(float, float, float); /*void extern output (float, float, float);*/ void extern myLabel(const char *, const char *); #endif // HEADER_H_INCLUDED main function //8.1 main // this progam... #include "header.h" int main() { float sideLength1, sideLength2, sideLength3; char response; do //main loop { input (sideLength1, sideLength2, sideLength3); triangleShape (sideLength1, sideLength2, sideLength3); //output (sideLength1, sideLength2, sideLength3); cout << "\nAny more triangles to analyze? (y,n) "; cin >> response; } while (response == 'Y' || response == 'y'); myLabel ("8.1", "2/11/2011"); return 0; } triangleShape shape # include "header.h" triangleType triangleShape(sideLenght1, sideLength2, sideLength3) { triangleType triangle; return triangle; }

    Read the article

  • Linked Lists in Java - Help with assignment

    - by doron2010
    I have been trying to solve this assignment all day, please help me. I'm completely lost. Representation of a string in linked lists In every intersection in the list there will be 3 fields : The letter itself. The number of times it appears consecutively. A pointer to the next intersection in the list. The following class CharNode represents a intersection in the list : public class CharNode { private char _data; private int _value; private charNode _next; public CharNode (char c, int val, charNode n) { _data = c; _value = val; _next = n; } public charNode getNext() { return _next; } public void setNext (charNode node) { _next = node; } public int getValue() { return _value; } public void setValue (int v) { value = v; } public char getData() { return _data; } public void setData (char c) { _data = c; } } The class StringList represents the whole list : public class StringList { private charNode _head; public StringList() { _head = null; } public StringList (CharNode node) { _head = node; } } Add methods to the class StringList according to the details : (Pay attention, these are methods from the class String and we want to fulfill them by the representation of a string by a list as explained above) public char charAt (int i) - returns the char in the place i in the string. Assume that the value of i is in the right range. public StringList concat (String str) - returns a string that consists of the string that it is operated on and in its end the string "str" is concatenated. public int indexOf (int ch) - returns the index in the string it is operated on of the first appeareance of the char "ch". If the char "ch" doesn't appear in the string, returns -1. If the value of fromIndex isn't in the range, returns -1. public int indexOf (int ch, int fromIndex) - returns the index in the string it is operated on of the first appeareance of the char "ch", as the search begins in the index "fromIndex". If the char "ch" doesn't appear in the string, returns -1. public boolean equals (String str) - returns true if the string that it is operated on is equal to the string str. Otherwise returns false. This method must be written in recursion, without using loops at all. public int compareTo (String str) - compares between the string that the method is operated on to the string "str" that is in the parameter. The method returns 0 if the strings are equal. If the string in the object is smaller lexicographic from the string "str" in the paramater, a negative number will be returned. And if the string in the object is bigger lexicographic from the string "str", a positive number will be returned. public StringList substring (int i) - returns the list of the substring that starts in the place i in the string on which it operates. Meaning, the sub-string from the place i until the end of the string. Assume the value of i is in the right range. public StringList substring (int i, int j) - returns the list of the substring that begins in the place i and ends in the place j (not included) in the string it operates on. Assume the values of i, j are in the right range. public int length() - will return the length of the string on which it operates. Pay attention to all the possible error cases. Write what is the time complexity and space complexity of every method that you wrote. Make sure the methods you wrote are effective. It is NOT allowed to use ready classes of Java. It is NOT allowed to move to string and use string operations.

    Read the article

  • Running a Java program with input from a file

    - by Katy
    I am writing a program that reads the input from a file and then prints it to the screen. When I run it without taking the input from the file, it works perfectly fine. However, every time I try to run it from the file it gives me an "Exception in thread "main" java.util.NoSuchElementException: No line found at" error that occurs every place the input is suppose to be read. I have no idea what is going on.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • Please quickly help with this problem I got 52 minutes left.

    - by Hamish Grubijan
    Write a program that prints the numbers from 1 to 100. But for multiples of three print "Fizz" instead of the number and for the multiples of five print "Buzz". For numbers which are multiples of both three and five print "FizzBuzz". Woman said use any common language. Please make it short and test it. My screen is small. Thanks. P.S. I have test anxiety particularly after talking to people in suits. I also stayed up all night studying Java codes.

    Read the article

  • Sorting arrays in java

    - by user360706
    Write a static method in Java : public static void sortByFour (int[] arr) That receives as a paramater an array full of non-negative numbers (zero or positive) and sorts the array in the following way : In the beginning of the array all the numbers that devide by four without a remainder will appear. After them all the numbers in the array that devide by 4 with a remainder of 1 will appear. After them all the numbers in the array that devide by 4 with a remainder of 2 will appear. In the end of the array all the rest numbers (those who divide by 4 with the remainder 3) will appear. (The order of the numbers in each group doesn't matter) The method must be the most efficient it can. This is what I wrote but unfortunately it doesn't work well... :( public static void swap( int[] arr, int left, int right ) { int temp = arr[left]; arr[left] = arr[right]; arr[right] = temp; } public static void sortByFour( int[] arr ) { int left = 0; int right = ( arr.length - 1 ); int mid = ( arr.length / 2 ); while ( left < right ) { if ( ( arr[left] % 4 ) > ( arr[right] % 4 ) ) { swap( arr, left, right ); right--; } if ( ( arr[left] % 4 ) == ( arr[right] % 4 ) ) left++; else left++; } } Can someone please help me by fixing my code so that it will work well or rewriting it?

    Read the article

  • How to create a simple Proxy to access web servers in C

    - by jesusiniesta
    Hi. I’m trying to create an small Web Proxy in C. First, I’m trying to get a webpage, sending a GET frame to the server. I don’t know what I have missed, but I am not receiving any response. I would really appreciate if you can help me to find what is missing in this code. int main (int argc, char** argv) { int cache_size, //size of the cache in KiB port, port_google = 80, dir, mySocket, socket_google; char google[] = "www.google.es", ip[16]; struct sockaddr_in socketAddr; char buffer[10000000]; if (GetParameters(argc,argv,&cache_size,&port) != 0) return -1; GetIP (google, ip); printf("ip2 = %s\n",ip); dir = inet_addr (ip); printf("ip3 = %i\n",dir); /* Creation of a socket with Google */ socket_google = conectClient (port_google, dir, &socketAddr); if (socket_google < 0) return -1; else printf("Socket created\n"); sprintf(buffer,"GET /index.html HTTP/1.1\r\n\r\n"); if (write(socket_google, (void*)buffer, LONGITUD_MSJ+1) < 0 ) return 1; else printf("GET frame sent\n"); strcpy(buffer,"\n"); read(socket_google, buffer, sizeof(buffer)); // strcpy(message,buffer); printf("%s\n", buffer); return 0; } And this is the code I use to create the socket. I think this part is OK, but I copy it just in case. int conectClient (int puerto, int direccion, struct sockaddr_in *socketAddr) { int mySocket; char error[1000]; if ( (mySocket = socket(AF_INET, SOCK_STREAM, 0)) == -1) { printf("Error when creating the socket\n"); return -2; } socketAddr->sin_family = AF_INET; socketAddr->sin_addr.s_addr = direccion; socketAddr->sin_port = htons(puerto); if (connect (mySocket, (struct sockaddr *)socketAddr,sizeof (*socketAddr)) == -1) { snprintf(error, sizeof(error), "Error in %s:%d\n", __FILE__, __LINE__); perror(error); printf("%s\n",error); printf ("-- Error when stablishing a connection\n"); return -1; } return mySocket; } Thanks!

    Read the article

  • Help in C with integers

    - by inferno2991
    You need to use division and remainder by 10. Consider this example: 163 divided by 10 is 16 remainder 3 16 divided by 10 is 1 remainder 6 1 divided by 10 is 0 remainder 1 You'll notice the remainder is always the last digit of the number that's being divided. Now figure out a way to do this in C... How do i do it in c Help :(

    Read the article

  • A two player game over the intranet..

    - by Santwana
    Hi everybody.. I am a student of 3rd year engineering and only a novice in my programming skills. I need some help with my project.. I wish to develop a two player game to be played over the network (Intranet). I want to develop a simple website with a few html pages for this.My ideas for the project run as follows: 1.People can log in from different systems and check who ever is online on the network currently. the page also shows who is playing with whom. 2.If a person is interested in playing with a player who is currently online, he sends a request of which the other player is somehow notified( using a message or an alert on his profile page..) 3.If the player accepts the request, a game is started. This is exactly where I am clueless.. How can I make them play the game? I need to develop a turn based game with two players, eg chessboard.. how can I do this? The game has to be played live.. and it is time tracked. i need your help with coding the above.. the other features i wish to include are: 4.The game could not be abruptly terminated by any one if the users.The request to terminate the game should be sent to the other player first and only if he accepts can the game be terminated. Whoever wins the game would get a plus 10 on their credit and if he terminated he gets a minus 10. The credits remains constant even if he loses but the success percentage is reduced. 6.The player with highest winning percentage is projected as the player of the week on the home page and he can post a challenge to all others.. I only have an intermediate knowledge of core java and know the basics of Swing and Awt. I am not at all familiar with networking in java right now. I have 5 to 6 weeks of time for developing the project but I hope to learn the things before I start my project. i would prefer to use a lan to illustrate the project and I know only java,jsp,oracle,html and bit of xml to develop my proj. Also I wish to know if I can code this within 6 weeks, would it be too difficult or complicated? Please spare some time to tell me. Please.. please.. I need your suggestions and help.. thank you so much..

    Read the article

  • circular shift c

    - by simion
    I am doing some past papers and noticed a question where i have to shift the int one place to the right and return it i no in java i can just return n 1; is this possible in c? or is there a typically more compelx way of doing it :D. The method we were given is as follows // Return n after a right circular 1-bit shift unsigned int right_circular_shift_1(unsigned int n) {

    Read the article

  • i see the file but when i open it nothing is in it in c++ i/o stream and dont know why

    - by user320950
    #include<iostream> #include<fstream> #include<cstdlib> #include<iomanip> using namespace std; int main() { ifstream in_stream; // reads ITEMSLIST.txt ofstream out_stream1; // writes in listWititems.txt ifstream in_stream2; // reads PRICELIST.txt ofstream out_stream3;// writes in listWitprices.txt ifstream in_stream4;// read display.txt ofstream out_stream5;// write showitems.txt double p1=0.0,p2=0.0; int wrong=0; int count =0; char next; in_stream.open("ITEMLIST.txt", ios::in); // list of avaliable items /*if( in_stream.fail() )// check to see if itemlist.txt is open { wrong++; // counts number of errors cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ out_stream1.open("listWititems.txt", ios::out); // list of avaliable items /* if( out_stream1.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ in_stream2.open("PRICELIST.txt", ios::in); /*if( in_stream2.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ out_stream3.open("listWitdollars.txt", ios::out); /*if( out_stream3.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ in_stream4.open("display.txt", ios::in); /*if( in_stream4.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; } */ out_stream5.open("showitems.txt", ios::out); /*if( out_stream5.fail() )// check to see if itemlist.txt is open { wrong++; cout << " the error occured here0, you have " << wrong++ << " errors" << endl; cout << "Error opening the file\n" << endl; exit(1); } else{ cout << " System ran correctly " << endl; }*/ in_stream.setf(ios::fixed); while(!in_stream.eof()) // reads to end of file and gets p1 which is itemnum, clears and gets next character { in_stream >> p1; cin.clear(); cin >> next; } out_stream1.setf(ios::fixed); while (!out_stream1.eof()) { out_stream1 << p1; cin.clear(); cin >> next; } in_stream2.setf(ios::fixed); in_stream2.setf(ios::showpoint); in_stream2.precision(2); while(!in_stream2.eof()) // reads file to end of file { in_stream2 >> p1 >> p2 >> count; // gets p1,p2, and count which is current total in_stream2 >> p2; p1 += p2; p2++; cin.clear(); // allows more reading cin >> next; return p1, p2; } out_stream3.setf(ios::fixed); out_stream3.setf(ios::showpoint); out_stream3.precision(2); while(!out_stream3.eof()) // reads file to end of file { out_stream3 << p1 << p2 << count; out_stream3 << p2; p1 += p2; p2++; cin.clear(); // allows more reading cin >> next; return p1, p2; } in_stream4.setf(ios::fixed); in_stream4.setf(ios::showpoint); in_stream4.precision(2); while (!in_stream4.eof()) { in_stream4 >> p1 >> p2 >> count; cin.clear(); cin >> next; } out_stream5.setf(ios::fixed); out_stream5.setf(ios::showpoint); out_stream5.precision(2); out_stream5 <<setw(5)<< " itemnum " <<setw(5)<<" price "<<setw(5)<<" curr_total " <<endl; // sends items and prices to receipt.txt out_stream5 << setw(5) << p1 << setw(5) <<p2 << setw(5)<< count; // sends items and prices to receipt.txt out_stream5 << " You have a total of " << wrong++ << " errors " << endl; in_stream.close(); // closing files. out_stream1.close(); in_stream2.close(); out_stream3.close(); in_stream4.close(); out_stream5.close(); system("pause"); }

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • Decrypt PHP encrypted string in C#

    - by NotDan
    I have a string encrypted in PHP that I would like to decrypt in C#. I used the tutorial below to do the encryption, but am having problems decrypting. Can anyone post an example on how to do this? http://www.sanity-free.org/131/triple_des_between_php_and_csharp.html

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

  • c++ tables of unions and structures

    - by newbDeveloper
    I was told to write a program, that creates a union and structure, then creates two-element arrays of unions and structures and fills their fields. I have created a union and a structure, but how to fill their fields in arrays ? #include <iostream> #include <stdlib.h> #include <stdio.h> using namespace std; union complex; union complex{ int i1; long double ld1; } u; struct Person { char* name; int age; bool sex; void show(){ printf("name %s, age %2.0d, sex %1d\n", name , age, sex); }; } person; int main(void) { Person *o = new Person[2]; complex *un = new complex[2]; un[0]->i1=i; system("pause"); return 0; } I've tried un[0]-i1=i; but it's not the proper way to do this.

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

< Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >