Search Results

Search found 33140 results on 1326 pages for 'skip list'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 749/1326 | < Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >

  • Changing the path a property is bound to at runtime

    - by Dave Colwell
    Hi, I have a ComboBox with a list of objects bound to it. Currently i have the items templated so they show only the property Class.Name. so the ComboBox is full of Class.Name However i am required to give the user the option to display the property Class.Description instead. If it were just that easy i would be fine, but they want the option to switch back and forth between them at runtime. Any ideas?

    Read the article

  • How can i resolve the N+1 Selects problem ?

    - by Maxime ARNSTAMM
    Hello everyone, I have trouble understanding how to avoid the n+1 select in jpa or hibernate. From what i read, there's the 'left join fetch', but i'm not sure if it still works with more than one list (oneToMany).. Could someone explain it to me, or give me a link with a clear complete explanation please ? I'm sorry if this is a noob question, but i can't find a real clear article or doc on this issue. Thanks

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • Flex Chart Colors

    - by maoanz
    When creating a flex Chart, the list of colors is always the same, something like (orange, green, blue, ... ) I imagine that the Flex Charts use any array of default colors, Is there a way to get this array ?

    Read the article

  • send email to single ExactTarget subscriber without TriggeredSend

    - by Max Gontar
    There is an email service ExactTarget with web service API. There are samples (in php though) for sending email to whole list instantly, or to single subscriber by triggered action. It's pretty hard to get in it's documentation, and I couldn't find explanation how to send email to a single subscriber instantly without having some triggering actions. Any help or advice will be great.

    Read the article

  • How do I create a Django ModelForm, so that it's fields are sometimes required, sometimes not?

    - by Graf
    Ok, here is the question. Imagine I have a ModelForm which have only two fields. like this one: class ColorForm(forms.Form): color_by_name = forms.CharField() color = forms.IntegerField(widget = forms.Select(choices=COLOR_CHOICES)) So a user can either input a color name, a choose it from a list. Color is required, but that doesn't mean, that user should enter it manually. There do I put validation, so that my code checks if user selected color in dropdownlist and if not then he should write it manually?

    Read the article

  • Testing an application for Android.

    - by Tarmon
    Hey Everyone, I was wondering if any one had compiled a list of the most commonly used Android devices so I can get an idea of what I should test for. Even better would be suggested configurations for emulating each device. Thanks, Rob

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JQUERY, appending an LI to a UL, and then animating that LI

    - by nobosh
    I have an UL: <ul id="news-feed">.....</ul> I'd like to be able to append a LI to the top of the list and have that appended item slideDown into place. $("#news-feed").append('<li">This is my item</li>').hide().slideDown(); Problem I'm having is the above code is sliding the news-feed item down, and not the appended item. Any ideas?

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Character sets offered in the Eclipse properties

    - by bmargulies
    I've just been handed a pile of Java source that, I suspect, is in ISO-8859-8. Eclipse's menu of charsets, here on my Mac, does not include that. Or any of a wide variety of other encodings supported by the JDK. Is there a recipe for expanding the list of encodings that show up in the menu?

    Read the article

  • Code coverage tools that can be used on .NET 4.0 assemblies

    - by Tim Duncan
    We use Xunit.net as our unit test framework for use on our .NET4 assemblies. We have it integrated into our TFS 2010 team builds quite successfully. I now want to add code coverage to the nightly builds as well. Does anyone have a list of coverage tools that work on 4.0 assemblies and could be integrated into our automated builds?

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • A standard event messaging system with AJAX?

    - by Gutzofter
    Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >