Search Results

Search found 33140 results on 1326 pages for 'skip list'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 749/1326 | < Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >

  • Flex Chart Colors

    - by maoanz
    When creating a flex Chart, the list of colors is always the same, something like (orange, green, blue, ... ) I imagine that the Flex Charts use any array of default colors, Is there a way to get this array ?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JQUERY, appending an LI to a UL, and then animating that LI

    - by nobosh
    I have an UL: <ul id="news-feed">.....</ul> I'd like to be able to append a LI to the top of the list and have that appended item slideDown into place. $("#news-feed").append('<li">This is my item</li>').hide().slideDown(); Problem I'm having is the above code is sliding the news-feed item down, and not the appended item. Any ideas?

    Read the article

  • Android: onListItemClick not getting called in ListActivity

    - by user521469
    I'm having problems with my first Android app. I have subclassed ListActivity, and I'm having no luck getting the overridden onListItemClick() to respond to click events. I've read focus can be a problem, but changing focus in the XML files does not seem to work. Here's the relevant bits of code. Anyone see what's I've buggered up? public class Notepadv1 extends ListActivity { private int mNoteNumber = 1; private NotesDbAdapter mDbHelper; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.notepad_list); mDbHelper = new NotesDbAdapter(this); mDbHelper.open(); fillData(); } private void fillData() { // Get all of the notes from the database and create the item list Cursor c = mDbHelper.fetchAllNotes(); startManagingCursor(c); String[] from = new String[] { NotesDbAdapter.KEY_TITLE }; int[] to = new int[] { R.id.text1 }; SimpleCursorAdapter notes = new SimpleCursorAdapter(this, R.layout.notes_row, c, from, to); setListAdapter(notes); } @Override public void onListItemClick (ListView l, View v, int position, long id){ super.onListItemClick(l, v, position, id); AlertDialog alert = new AlertDialog.Builder(this).create(); String message = "row clicked!"; alert.setMessage(message); alert.show(); } notepad_list.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@android:id/list" android:layout_width="wrap_content" android:layout_height="wrap_content" android:dividerHeight="6dp"/> <TextView android:id="@android:id/empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/no_notes" /> </LinearLayout> And notes_row.xml <?xml version="1.0" encoding="utf-8"?> <TextView android:id="@+id/text1" xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="60dp" android:focusable="false"/>

    Read the article

  • Grouping Records with the same value

    - by Ben
    I am trying to create a conversations based messaging system. I want to group all messages that have the same conversation_id so that when I display a list of current conversations you only see the latest message from each conversation. Can I group the values in the mysql query, or would I have to do it in the php?

    Read the article

  • SQLite3 Integer Max Value

    - by peterwkc
    Hello to all, what is the maximum value of data type INTEGER in sqlite3 ? How do you store ip address in database ? What is attached ? How to create table which belongs to a specific database using sql ddl? What is this error about ? error while the list of system catalogue : no such table: temp.sqlite_master Unable to execute statement Does sqlite3 text data type supoports unicode? Thanks.

    Read the article

  • valuechangelistener in jsf

    - by chetan
    public void departmentChangeListener(ValueChangeEvent event){ Long id = (Long) event.getNewValue(); department = id; if(department == -1 || department == 0){ employee=0; displayEmployee = false; } else{ changeEmployee(); employee=0; displayEmployee = true; } } This is the method that call in valuechangeListener attribute of ice:selectOneMenu tag but here problem is value of employee set 0 when we second time change value from selectOneMenu's List.

    Read the article

  • how to update only the updated rows in gridview?

    - by user603007
    what is the handiest way to update only the updated rows (only the checkbox column) in this gridview? what is a handy way to check wether the row was updated? c# public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { List<customer> listCustomer = new List<customer>(); customer cust1 = new customer(){name="fred",email="[email protected]",jobless="true"}; customer cust2 = new customer(){name="mark",email="[email protected]",jobless="false"}; listCustomer.Add(cust1); listCustomer.Add(cust2); GridView1.DataSource=listCustomer; GridView1.DataBind(); } } protected void btnUpdate_Click1(object sender, EventArgs e) { foreach (GridViewRow rw in GridView1.Rows) { CheckBox thiscontrol = (CheckBox)rw.Cells[0].FindControl("cb"); var ch = thiscontrol.Checked; //only update the updated rows? } } public class customer { public string name { get; set; } public string email { get; set; } public string jobless { get; set; } } html <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="Default.aspx.cs" Inherits="gridviewUpdate._Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div> <asp:GridView ID="GridView1" AutoGenerateColumns="false" runat="server"> <Columns> <asp:TemplateField> <ItemTemplate> <asp:CheckBox ID="jobless" runat="server" Checked='<%# Eval("jobless").ToString().Equals("true") %>' /> </ItemTemplate> </asp:TemplateField> <asp:BoundField DataField="email" /> <asp:BoundField DataField="name" /> </Columns> </asp:GridView> </div>

    Read the article

  • Accessing a namespace containing .base in its name from F#

    - by emaster70
    As the title says, I'm trying to use a class declared in a namespace which contains "base" in its name. Think of a situation like the following: open Foo.base.Bar In C# I'd just use @ before base but F# seems to ignore that and to think that @ is the infix operator used for list concatenation. Since the namespace belongs to a third-party library which I cannot modify, is there a way I can still access it from F#?

    Read the article

  • How to write a contains statement to match a member of a class?

    - by afuzzyllama
    If I have the following structure: Public Class UserData Public ID As String Public Name As String End Class How can I select it in a conditional like this? Dim myUsers As New List(Of UserData) If myUsers.Contains(.ID = "1") = True Then ... I know that myUsers.Contains(.ID = "1") is totally wrong, but I am curious how to do something like that? Is it possible? Is this a job for LINQ?

    Read the article

  • Can you return an array from a JAX-WS @WebMethod?

    - by LES2
    I'm pretty sure you can, but in addition to answering the question in the title, could you also explain the pros, cons, caveats, if any, to doing so? I know that you can't return a List, Set, Collection, Map, or any interface, from a WebMethod (which is stupid, IMO, but I don't know what the design reasons were should I should probably withhold judgment). Thanks for any advice. -- LES

    Read the article

  • POS for .NET Known Service Objects

    - by Oliver S
    Hi, I was wondering if anyone knew where I could find a list of LineDisplays, CashDrawers, Printers, that work well with POS for .NET. I want to get around creating my own service objects for potential devices that I might by which are not supported. Thanks.

    Read the article

  • SQL Update to the SUM of its joined values

    - by CL4NCY
    Hi, I'm trying to update a field in the database to the sum of its joined values: UPDATE P SET extrasPrice = SUM(E.price) FROM dbo.BookingPitchExtras AS E INNER JOIN dbo.BookingPitches AS P ON E.pitchID = P.ID AND P.bookingID = 1 WHERE E.[required] = 1 When I run this I get the following error: "An aggregate may not appear in the set list of an UPDATE statement." Any ideas?

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • How do I create a ListBox In Ext-GWT ?

    - by Salvin Francis
    Plain and Simple, I want to use a Listbox in my project, The demo here: http://www.extjs.com/examples shows no answer, In fact, I really hate it when companies show-off their 'complex' widgets in this manner and fail to show the most basic of all widgets. For example, I discovered class SimpleComboBox over the net till then I assumed that we required a class to contain list store, etc...

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >