Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 749/1326 | < Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >

  • Flex Chart Colors

    - by maoanz
    When creating a flex Chart, the list of colors is always the same, something like (orange, green, blue, ... ) I imagine that the Flex Charts use any array of default colors, Is there a way to get this array ?

    Read the article

  • valuechangelistener in jsf

    - by chetan
    public void departmentChangeListener(ValueChangeEvent event){ Long id = (Long) event.getNewValue(); department = id; if(department == -1 || department == 0){ employee=0; displayEmployee = false; } else{ changeEmployee(); employee=0; displayEmployee = true; } } This is the method that call in valuechangeListener attribute of ice:selectOneMenu tag but here problem is value of employee set 0 when we second time change value from selectOneMenu's List.

    Read the article

  • how to update only the updated rows in gridview?

    - by user603007
    what is the handiest way to update only the updated rows (only the checkbox column) in this gridview? what is a handy way to check wether the row was updated? c# public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { List<customer> listCustomer = new List<customer>(); customer cust1 = new customer(){name="fred",email="[email protected]",jobless="true"}; customer cust2 = new customer(){name="mark",email="[email protected]",jobless="false"}; listCustomer.Add(cust1); listCustomer.Add(cust2); GridView1.DataSource=listCustomer; GridView1.DataBind(); } } protected void btnUpdate_Click1(object sender, EventArgs e) { foreach (GridViewRow rw in GridView1.Rows) { CheckBox thiscontrol = (CheckBox)rw.Cells[0].FindControl("cb"); var ch = thiscontrol.Checked; //only update the updated rows? } } public class customer { public string name { get; set; } public string email { get; set; } public string jobless { get; set; } } html <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="Default.aspx.cs" Inherits="gridviewUpdate._Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div> <asp:GridView ID="GridView1" AutoGenerateColumns="false" runat="server"> <Columns> <asp:TemplateField> <ItemTemplate> <asp:CheckBox ID="jobless" runat="server" Checked='<%# Eval("jobless").ToString().Equals("true") %>' /> </ItemTemplate> </asp:TemplateField> <asp:BoundField DataField="email" /> <asp:BoundField DataField="name" /> </Columns> </asp:GridView> </div>

    Read the article

  • cleanup all UIComponents inside mx:Application

    - by user267530
    Hi I create some elements( UIComponents, mainly Panels) inside the “mx:Application name=”tst” “. I need to cleanup all those UIComponent’s on MouseClick event , using Actionscript. Is there any way I access the children elements of mx:Application ( I used var totalChildren:Number = this[‘tst’].numChildren ; but looks like it fails to access the children list). Thanks Palash

    Read the article

  • dynamic drop down

    - by sarah
    Hi, i want to display a drop down dynamically that is the values should be from database,i have the list holding the values,how would i use it now ?

    Read the article

  • Remove then Query fails in JPA/Hibernate (deleted entity passed to persist)

    - by Kevin
    I've got a problem with the removal of entities in my JPA application: basically, I do in this EJB Business method: load photo list ; for each photo { //UPDATE remove TagPhoto element from @OneToMany relation //DISPLAY create query involving TagPhoto ... } and this last query always throws an EntityNotFoundException (deleted entity passed to persist: [...TagPhoto#]) I think I understand the meaning of this exception, like a synchronization problem caused by my Remove, but how can I get rid of it?

    Read the article

  • Translating C++'s sprintf format string to C#'s string.Format

    - by thebackup
    I found the following C++ code (comments added myself): // frame_name is a char array // prefix is std::string // k is a for loop counter // frames is a std::vector string sprintf(frameName, "%s_%0*s.bmp", prefix.c_str(), k, frames[k].c_str()); I then try to translate it to C# // prefix is string // k is a for loop counter // frames is List<string> string frameName = string.Format("{0}_(what goes in here?).bmp", prefix, k, frames[k]); Basically, what would be the C# equivalent of the C++ format string "%s_%0*s.bmp"?

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • How do I create a ListBox In Ext-GWT ?

    - by Salvin Francis
    Plain and Simple, I want to use a Listbox in my project, The demo here: http://www.extjs.com/examples shows no answer, In fact, I really hate it when companies show-off their 'complex' widgets in this manner and fail to show the most basic of all widgets. For example, I discovered class SimpleComboBox over the net till then I assumed that we required a class to contain list store, etc...

    Read the article

  • Can you return an array from a JAX-WS @WebMethod?

    - by LES2
    I'm pretty sure you can, but in addition to answering the question in the title, could you also explain the pros, cons, caveats, if any, to doing so? I know that you can't return a List, Set, Collection, Map, or any interface, from a WebMethod (which is stupid, IMO, but I don't know what the design reasons were should I should probably withhold judgment). Thanks for any advice. -- LES

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • Grouping Records with the same value

    - by Ben
    I am trying to create a conversations based messaging system. I want to group all messages that have the same conversation_id so that when I display a list of current conversations you only see the latest message from each conversation. Can I group the values in the mysql query, or would I have to do it in the php?

    Read the article

  • Eclipse Python Integration

    - by BCS
    I found this python plugin list but thought I'd ask if anyone has any experience with anything listed there? I'm totally new to both python and dynamic programming languages if that makes any difference.

    Read the article

  • SQL Update to the SUM of its joined values

    - by CL4NCY
    Hi, I'm trying to update a field in the database to the sum of its joined values: UPDATE P SET extrasPrice = SUM(E.price) FROM dbo.BookingPitchExtras AS E INNER JOIN dbo.BookingPitches AS P ON E.pitchID = P.ID AND P.bookingID = 1 WHERE E.[required] = 1 When I run this I get the following error: "An aggregate may not appear in the set list of an UPDATE statement." Any ideas?

    Read the article

< Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >