Search Results

Search found 33140 results on 1326 pages for 'skip list'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 749/1326 | < Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >

  • Changing the path a property is bound to at runtime

    - by Dave Colwell
    Hi, I have a ComboBox with a list of objects bound to it. Currently i have the items templated so they show only the property Class.Name. so the ComboBox is full of Class.Name However i am required to give the user the option to display the property Class.Description instead. If it were just that easy i would be fine, but they want the option to switch back and forth between them at runtime. Any ideas?

    Read the article

  • loading input from multi choice

    - by dankyy1
    Hi I have a task as that a dropdown list to choose an input type selections are textbox datetime number while choosing one of those types, I have to open the selected input(for example if user chose datetime I have to open a datetime input) For this task which is most suitable using aspview(each input type one view) for each one a usercontrol so when user select a type loading it's usercontrol at runtime or do you have any better ideas?

    Read the article

  • Character sets offered in the Eclipse properties

    - by bmargulies
    I've just been handed a pile of Java source that, I suspect, is in ISO-8859-8. Eclipse's menu of charsets, here on my Mac, does not include that. Or any of a wide variety of other encodings supported by the JDK. Is there a recipe for expanding the list of encodings that show up in the menu?

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • How do I create a Django ModelForm, so that it's fields are sometimes required, sometimes not?

    - by Graf
    Ok, here is the question. Imagine I have a ModelForm which have only two fields. like this one: class ColorForm(forms.Form): color_by_name = forms.CharField() color = forms.IntegerField(widget = forms.Select(choices=COLOR_CHOICES)) So a user can either input a color name, a choose it from a list. Color is required, but that doesn't mean, that user should enter it manually. There do I put validation, so that my code checks if user selected color in dropdownlist and if not then he should write it manually?

    Read the article

  • send email to single ExactTarget subscriber without TriggeredSend

    - by Max Gontar
    There is an email service ExactTarget with web service API. There are samples (in php though) for sending email to whole list instantly, or to single subscriber by triggered action. It's pretty hard to get in it's documentation, and I couldn't find explanation how to send email to a single subscriber instantly without having some triggering actions. Any help or advice will be great.

    Read the article

  • Formatting numbers with significant figures in C#

    - by Chris Farmer
    I have some decimal data that I am pushing into a SharePoint list where it is to be viewed. I'd like to restrict the number of significant figures displayed in the result data based on my knowledge of the specific calculation. Sometimes it'll be 3, so 12345 will become 12300 and 0.012345 will become 0.0123. Occasionally it will be 4 or 5. Is there any convenient way to handle this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • cleanup all UIComponents inside mx:Application

    - by user267530
    Hi I create some elements( UIComponents, mainly Panels) inside the “mx:Application name=”tst” “. I need to cleanup all those UIComponent’s on MouseClick event , using Actionscript. Is there any way I access the children elements of mx:Application ( I used var totalChildren:Number = this[‘tst’].numChildren ; but looks like it fails to access the children list). Thanks Palash

    Read the article

  • Flex Chart Colors

    - by maoanz
    When creating a flex Chart, the list of colors is always the same, something like (orange, green, blue, ... ) I imagine that the Flex Charts use any array of default colors, Is there a way to get this array ?

    Read the article

  • Testing an application for Android.

    - by Tarmon
    Hey Everyone, I was wondering if any one had compiled a list of the most commonly used Android devices so I can get an idea of what I should test for. Even better would be suggested configurations for emulating each device. Thanks, Rob

    Read the article

  • JQUERY, appending an LI to a UL, and then animating that LI

    - by nobosh
    I have an UL: <ul id="news-feed">.....</ul> I'd like to be able to append a LI to the top of the list and have that appended item slideDown into place. $("#news-feed").append('<li">This is my item</li>').hide().slideDown(); Problem I'm having is the above code is sliding the news-feed item down, and not the appended item. Any ideas?

    Read the article

  • How to write a contains statement to match a member of a class?

    - by afuzzyllama
    If I have the following structure: Public Class UserData Public ID As String Public Name As String End Class How can I select it in a conditional like this? Dim myUsers As New List(Of UserData) If myUsers.Contains(.ID = "1") = True Then ... I know that myUsers.Contains(.ID = "1") is totally wrong, but I am curious how to do something like that? Is it possible? Is this a job for LINQ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >