Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 749/1326 | < Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >

  • valuechangelistener in jsf

    - by chetan
    public void departmentChangeListener(ValueChangeEvent event){ Long id = (Long) event.getNewValue(); department = id; if(department == -1 || department == 0){ employee=0; displayEmployee = false; } else{ changeEmployee(); employee=0; displayEmployee = true; } } This is the method that call in valuechangeListener attribute of ice:selectOneMenu tag but here problem is value of employee set 0 when we second time change value from selectOneMenu's List.

    Read the article

  • Is there any online free movie information api's?

    - by Gary Willoughby
    For music there is the Gracenote CDDB SDK, etc. but does an online service exist for getting information about movies? The only solution i can see at the minute is querying IMDB and scraping the page. The problem i have is that i have a list of film titles and i want to retrieve stuff like the plot, director, cast, when released, get dvd cover art, etc..

    Read the article

  • ASP.Net 4.0 Database Created Pages

    - by Tyler
    I want to create asp.net 4.0 dynamic pages loaded from my MS SQL server. Basically, its a list of locations with informations. For example: Location1 would have the page www.site.com/location/location1.aspx Location44 would have the page www.site.com/location/location44.aspx I dont even know where to start with this, url writting maybe?

    Read the article

  • cleanup all UIComponents inside mx:Application

    - by user267530
    Hi I create some elements( UIComponents, mainly Panels) inside the “mx:Application name=”tst” “. I need to cleanup all those UIComponent’s on MouseClick event , using Actionscript. Is there any way I access the children elements of mx:Application ( I used var totalChildren:Number = this[‘tst’].numChildren ; but looks like it fails to access the children list). Thanks Palash

    Read the article

  • JQUERY, appending an LI to a UL, and then animating that LI

    - by nobosh
    I have an UL: <ul id="news-feed">.....</ul> I'd like to be able to append a LI to the top of the list and have that appended item slideDown into place. $("#news-feed").append('<li">This is my item</li>').hide().slideDown(); Problem I'm having is the above code is sliding the news-feed item down, and not the appended item. Any ideas?

    Read the article

  • Good looking programs that are built using wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • Calculation error in Datasheet view in SharePoint

    - by Marius
    I have a custom list, with calculation, in SharePoint. Everything worked fine until recently when the DataSheet will show strange or wrong % calculation in a % column. But the Standard View will show correct values. IT checked the server side and everything looked ok, I checked the formulas and even re-did them in the column and the issue persist. Anyone, any suggestion? Thanks,

    Read the article

  • How do I create a ListBox In Ext-GWT ?

    - by Salvin Francis
    Plain and Simple, I want to use a Listbox in my project, The demo here: http://www.extjs.com/examples shows no answer, In fact, I really hate it when companies show-off their 'complex' widgets in this manner and fail to show the most basic of all widgets. For example, I discovered class SimpleComboBox over the net till then I assumed that we required a class to contain list store, etc...

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • Translating C++'s sprintf format string to C#'s string.Format

    - by thebackup
    I found the following C++ code (comments added myself): // frame_name is a char array // prefix is std::string // k is a for loop counter // frames is a std::vector string sprintf(frameName, "%s_%0*s.bmp", prefix.c_str(), k, frames[k].c_str()); I then try to translate it to C# // prefix is string // k is a for loop counter // frames is List<string> string frameName = string.Format("{0}_(what goes in here?).bmp", prefix, k, frames[k]); Basically, what would be the C# equivalent of the C++ format string "%s_%0*s.bmp"?

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Eclipse Python Integration

    - by BCS
    I found this python plugin list but thought I'd ask if anyone has any experience with anything listed there? I'm totally new to both python and dynamic programming languages if that makes any difference.

    Read the article

  • Flex Chart Colors

    - by maoanz
    When creating a flex Chart, the list of colors is always the same, something like (orange, green, blue, ... ) I imagine that the Flex Charts use any array of default colors, Is there a way to get this array ?

    Read the article

  • Can you return an array from a JAX-WS @WebMethod?

    - by LES2
    I'm pretty sure you can, but in addition to answering the question in the title, could you also explain the pros, cons, caveats, if any, to doing so? I know that you can't return a List, Set, Collection, Map, or any interface, from a WebMethod (which is stupid, IMO, but I don't know what the design reasons were should I should probably withhold judgment). Thanks for any advice. -- LES

    Read the article

  • Formatting numbers with significant figures in C#

    - by Chris Farmer
    I have some decimal data that I am pushing into a SharePoint list where it is to be viewed. I'd like to restrict the number of significant figures displayed in the result data based on my knowledge of the specific calculation. Sometimes it'll be 3, so 12345 will become 12300 and 0.012345 will become 0.0123. Occasionally it will be 4 or 5. Is there any convenient way to handle this?

    Read the article

  • Accessing a namespace containing .base in its name from F#

    - by emaster70
    As the title says, I'm trying to use a class declared in a namespace which contains "base" in its name. Think of a situation like the following: open Foo.base.Bar In C# I'd just use @ before base but F# seems to ignore that and to think that @ is the infix operator used for list concatenation. Since the namespace belongs to a third-party library which I cannot modify, is there a way I can still access it from F#?

    Read the article

  • SQL Update to the SUM of its joined values

    - by CL4NCY
    Hi, I'm trying to update a field in the database to the sum of its joined values: UPDATE P SET extrasPrice = SUM(E.price) FROM dbo.BookingPitchExtras AS E INNER JOIN dbo.BookingPitches AS P ON E.pitchID = P.ID AND P.bookingID = 1 WHERE E.[required] = 1 When I run this I get the following error: "An aggregate may not appear in the set list of an UPDATE statement." Any ideas?

    Read the article

  • Grouping Records with the same value

    - by Ben
    I am trying to create a conversations based messaging system. I want to group all messages that have the same conversation_id so that when I display a list of current conversations you only see the latest message from each conversation. Can I group the values in the mysql query, or would I have to do it in the php?

    Read the article

  • Remove then Query fails in JPA/Hibernate (deleted entity passed to persist)

    - by Kevin
    I've got a problem with the removal of entities in my JPA application: basically, I do in this EJB Business method: load photo list ; for each photo { //UPDATE remove TagPhoto element from @OneToMany relation //DISPLAY create query involving TagPhoto ... } and this last query always throws an EntityNotFoundException (deleted entity passed to persist: [...TagPhoto#]) I think I understand the meaning of this exception, like a synchronization problem caused by my Remove, but how can I get rid of it?

    Read the article

< Previous Page | 745 746 747 748 749 750 751 752 753 754 755 756  | Next Page >