Search Results

Search found 4520 results on 181 pages for 'notice'.

Page 159/181 | < Previous Page | 155 156 157 158 159 160 161 162 163 164 165 166  | Next Page >

  • Move namespace declaration from payload to envelope on an axis created web service

    - by rmarimon
    I just created a web service client using axis and eclipse that does not work with my web service provider. The message created by the web service client looks like this: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <soapenv:Body> <enviarMensajeRequest xmlns="http://www.springframework.org/spring-ws/Imk-Zenkiu-Services"> <usuario>someuser</usuario> <clave>somepassword</clave> <mensaje>somemessage</mensaje> <contacto> <buzonSMS>somenumber</buzonSMS> <primerNombre>somefirstname</primerNombre> <primerApellido>somelastname</primerApellido> </contacto> </enviarMensajeRequest> </soapenv:Body> </soapenv:Envelope> I see nothing wrong with the message but my provider insists the message should be: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:imk="http://www.springframework.org/spring-ws/Imk-Zenkiu-Services"> <soapenv:Body> <imk:enviarMensajeRequest> <imk:usuario>someuser</imk:usuario> <imk:clave>somepassword</imk:clave> <imk:mensaje>somemessage</imk:mensaje> <imk:contacto> <imk:buzonSMS>somenumber</imk:buzonSMS> <imk:primerNombre>somefirstname</imk:primerNombre> <imk:primerApellido>somelastname</imk:primerApellido> </imk:contacto> </imk:enviarMensajeRequest> </soapenv:Body> </soapenv:Envelope> Notice the namespace declaration moving from the enviarMensajeRequest to the soapenv:Envelope and the qualification with imk: on the parameters. I've tried many combinations on the process but my web service, wsdl and xml knowledge is very limited. The provider says that they can't help beyond telling me this. Any ideas? Perhaps a different framework that I can use to create the correct client.

    Read the article

  • git filter-branch chmod

    - by Evan Purkhiser
    I accidental had my umask set incorrectly for the past few months and somehow didn't notice. One of my git repositories has many files marked as executable that should be just 644. This repo has one main master branch, and about 4 private feature branches (that I keep rebased on top of the master). I've corrected the files in my master branch by running find -type f -exec chmod 644 {} \; and committing the changes. I then rebased my feature branches onto master. The problem is there are newly created files in the feature branches that are only in that branch, so they weren't corrected by my massive chmod commit. I didn't want to create a new commit for each feature branch that does the same thing as the commit I made on master. So I decided it would be best to go back through to each commit where a file was made and set the permissions. This is what I tried: git filter-branch -f --tree-filter 'chmod 644 `git show --diff-filter=ACR --pretty="format:" --name-only $GIT_COMMIT`; git add .' master.. It looked like this worked, but upon further inspection I noticed that the every commit after a commit containing a new file with the proper permissions of 644 would actually revert the change with something like: diff --git a b old mode 100644 new mode 100755 I can't for the life of me figure out why this is happening. I think I must be mis-understanding how git filter-branch works. My Solution I've managed to fix my problem using this command: git filter-branch -f --tree-filter 'FILES="$FILES "`git show --diff-filter=ACMR --pretty="format:" --name-only $GIT_COMMIT`; chmod 644 $FILES; true' development.. I keep adding onto the FILES variable to ensure that in each commit any file created at some point has the proper mode. However, I'm still not sure I really understand why git tracks the file mode for each commit. I had though that since I had fixed the mode of the file when it was first created that it would stay that mode unless one of my other commits explicit changed it to something else. That did not appear to the be the case. The reason I thought that this would work is from my understanding of rebase. If I go back to HEAD~5 and change a line of code, that change is propagated through, it doesn't just get changed back in HEAD~4.

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • How to access a grid inside of a RichTextBox in Silverlight 4?

    - by benrick
    I am trying to allow a user to create a table inside of a RichTextBox. I can create a Grid inside of the RichTextBox, but I am having some issues with it. I start with this XAML in the Grid. <RichTextBox Name="TB1" AcceptsReturn="True"> <Paragraph TextAlignment="Center"> Hi everybody </Paragraph> <Paragraph> <InlineUIContainer> <Grid Background="Black"> <Grid.RowDefinitions> <RowDefinition Height="10" /> <RowDefinition Height="10" /> </Grid.RowDefinitions> <Grid.ColumnDefinitions> <ColumnDefinition Width="10" /> <ColumnDefinition Width="10" /> </Grid.ColumnDefinitions> </Grid> </InlineUIContainer> </Paragraph> <Paragraph> How are you today? </Paragraph> </RichTextBox> Then when I get the XAML out using the Xaml property of the RichTextBox I get this XAML. <Section xml:space="preserve" HasTrailingParagraphBreakOnPaste="False" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"> <Paragraph FontSize="11" FontFamily="Portable User Interface" Foreground="#FF000000" FontWeight="Normal" FontStyle="Normal" FontStretch="Normal" TextAlignment="Center"> <Run Text="Hi everybody" /> </Paragraph> <Paragraph FontSize="11" FontFamily="Portable User Interface" Foreground="#FF000000" FontWeight="Normal" FontStyle="Normal" FontStretch="Normal" TextAlignment="Left"> <Run /> </Paragraph> <Paragraph FontSize="11" FontFamily="Portable User Interface" Foreground="#FF000000" FontWeight="Normal" FontStyle="Normal" FontStretch="Normal" TextAlignment="Left"> <Run Text="How are you today?" /> </Paragraph> </Section> Notice here that the Grid has turned into an empty Run element. Anyone know why this happens?

    Read the article

  • Make html footer occupy the rest of the body

    - by w0rldart
    So I am trying to code the footer of my web app of it occupies the rest of the body's height. Picture: http://img1.uploadscreenshot.com/images/orig/3/8906151296-orig.png Notice the light area beneath the dark area, the dark area should occupy all of it. Some of my html code: <body> .... <footer> <hr> <ul id="footerContainer"> <li class="right"> <ul> <li> <a href="" class="family-filter">Filtro Fami....</a> </li> </ul> </li> </ul> </footer> <script>...</script> </body></html> CSS: .... #footerContainer {width: 90%; min-width: 525px; margin: 0 auto; position: relative;} .... footer hr{ border: 0; height: 30px; background: url('../imgs/footer-top.png') repeat-x scroll; } footer { background: url('../imgs/footer-bg.png') repeat scroll bottom; height: 100%; display: block; margin: 0 auto; padding: 0; overflow: auto; } #footerContainer {margin: 0 auto; position: relative;} #footerContainer li { display: inline;} #footerContainer li .right {float: right;} #footerContainer li a {} Any suggestions? Update1: This is what happens: http://img1.uploadscreenshot.com/images/orig/3/8906391235-orig.png when I set html,body { width: 100%; height: 100%; margin: 0; padding: 0; } Update2: http://awesomescreenshot.com/0382hf1ff Zoom out and in at this page: line25.com/wp-content/uploads/2010/blog-design-coded/demo/… and check the footer area, that's how I need it work on my layout.

    Read the article

  • how to delete fk children in nhibernate

    - by frosty
    I would like to delete the ICollection PriceBreaks from Product. I'm using the following method. However they dont seem to delete. What am i missing. When i step thru. i notice that "product.PriceBreaks.Clear();" doesn't actually clear the items. Do i need to flush or something? public void RemovePriceBreak(int productId) { using (ISession session = EStore.Domain.Helpers.NHibernateHelper.OpenSession()) using (ITransaction transaction = session.BeginTransaction()) { var product = session.Get<Product>(productId); product.PriceBreaks.Clear(); session.SaveOrUpdate(product); transaction.Commit(); } } Here are my hbm files <class name="Product" table="Products"> <id name="Id" type="Int32" column="Id" unsaved-value="0"> <generator class="identity"/> </id> <property name="CompanyId" column="CompanyId" type="Int32" not-null="true" /> <property name="Name" column="Name"/> <set name="PriceBreaks" table="PriceBreaks" generic="true" cascade="all-delete-orphan" inverse="true" > <key column="ProductId" /> <one-to-many class="EStore.Domain.Model.PriceBreak, EStore.Domain" /> </set> </class> <class name="PriceBreak" table="PriceBreaks"> <id name="Id" type="Int32" column="Id" unsaved-value="0"> <generator class="identity"/> </id> <many-to-one name="Product" column="ProductId" not-null="true" cascade="all" class="EStore.Domain.Model.Product, EStore.Domain" /> </class> My Entities public class Product { public virtual int Id { get; set; } public virtual ICollection<PriceBreak> PriceBreaks { get; set; } public virtual void AddPriceBreak(PriceBreak priceBreak) { priceBreak.Product = this; PriceBreaks.Add(priceBreak); } } public class PriceBreak { public virtual int Id { get; set; } public virtual Product Product { get; set; } }

    Read the article

  • NHibernate Many to Many delete all my data in the table

    - by Daoming Yang
    I would love to thank @Stefan Steinegger and @David helped me out yesterday with many-to-many mapping. I have 3 tables which are "News", "Tags" and "News_Tags" with Many-To-Many relationship and the "News_Tags" is the link table. If I delete one of the news records, the following mappings will delete all my news records which have the same tags. One thing I need to notice, I only allowed unique tag stored in the "Tag" table. This mapping make sense for me, it will delete the tag and related News records, but how can I implement a tagging system with NHibernate? Can anyone give me some suggestion? Many thanks. Daoming. News Mapping: <class name="New" table="News" lazy="false"> <id name="NewID"> <generator class="identity" /> </id> <property name="Title" type="String"></property> <property name="Description" type="String"></property> <set name="TagsList" table="New_Tags" lazy="false" inverse="true" cascade="all"> <key column="NewID" /> <many-to-many class="Tag" column="TagID" /> </set> </class> Tag Mapping: <class name="Tag" table="Tags" lazy="false"> <id name="TagID"> <generator class="identity" /> </id> <property name="TagName" type="String"></property> <property name="DateCreated" type="DateTime"></property> <!--inverse="true" has been defined in the "News mapping"--> <set name="NewsList" table="New_Tags" lazy="false" cascade="all"> <key column="TagID" /> <many-to-many class="New" column="NewID" /> </set> </class>

    Read the article

  • Strange Map Reduce Behavior in CouchDB. Rereduce?

    - by Tony
    I have a mapreduce issue with couchdb (both functions shown below): when I run it with grouplevel = 2 (exact) I get accurate output: {"rows":[ {"key":["2011-01-11","staff-1"],"value":{"total":895.72,"count":2,"services":6,"services_ignored":6,"services_liked":0,"services_disliked":0,"services_disliked_avg":0,"Revise":{"total":275.72,"count":1},"Review":{"total":620,"count":1}}}, {"key":["2011-01-11","staff-2"],"value":{"total":8461.689999999999,"count":2,"services":41,"services_ignored":37,"services_liked":4,"services_disliked":0,"services_disliked_avg":0,"Revise":{"total":4432.4,"count":1},"Review":{"total":4029.29,"count":1}}}, {"key":["2011-01-11","staff-3"],"value":{"total":2100.72,"count":1,"services":10,"services_ignored":4,"services_liked":3,"services_disliked":3,"services_disliked_avg":2.3333333333333335,"Revise":{"total":2100.72,"count":1}}}, However, changing to grouplevel=1 so the values for all the different staff keys should be all grouped by date no longer gives accurate output (notice the total is currect but all others are wrong): {"rows":[ {"key":["2011-01-11"],"value":{"total":11458.130000000001,"count":2,"services":0,"services_ignored":0,"services_liked":0,"services_disliked":0,"services_disliked_avg":0,"None":{"total":11458.130000000001,"count":2}}}, My only theory is this has something to do with rereduce, which I have not yet learned. Should I explore that option or am I missing something else here? This is the Map function: function(doc) { if(doc.doc_type == 'Feedback') { emit([doc.date.split('T')[0], doc.staff_id], doc); } } And this is the Reduce: function(keys, vals) { // sum all key points by status: total, count, services (liked, rejected, ignored) var ret = { 'total':0, 'count':0, 'services': 0, 'services_ignored': 0, 'services_liked': 0, 'services_disliked': 0, 'services_disliked_avg': 0, }; var total_disliked_score = 0; // handle status function handle_status(doc) { if(!doc.status || doc.status == '' || doc.status == undefined) { status = 'None'; } else if (doc.status == 'Declined') { status = 'Rejected'; } else { status = doc.status; } if(!ret[status]) ret[status] = {'total':0, 'count':0}; ret[status]['total'] += doc.total; ret[status]['count'] += 1; }; // handle likes / dislikes function handle_services(services) { ret.services += services.length; for(var a in services) { if (services[a].user_likes == 10) { ret.services_liked += 1; } else if (services[a].user_likes >= 1) { ret.services_disliked += 1; total_disliked_score += services[a].user_likes; if (total_disliked_score >= ret.services_disliked) { ret.services_disliked_avg = total_disliked_score / ret.services_disliked; } } else { ret.services_ignored += 1; } } } // loop thru docs for(var i in vals) { // increment the total $ ret.total += vals[i].total; ret.count += 1; // update totals and sums for the status of this route handle_status(vals[i]); // do the likes / dislikes stats if(vals[i].groups) { for(var ii in vals[i].groups) { if(vals[i].groups[ii].services) { handle_services(vals[i].groups[ii].services); } } } // handle deleted services if(vals[i].hidden_services) { if (vals[i].hidden_services) { handle_services(vals[i].hidden_services); } } } return ret; }

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • What regular expression(s) would I use to remove escaped html from large sets of data.

    - by Elizabeth Buckwalter
    Our database is filled with articles retrieved from RSS feeds. I was unsure of what data I would be getting, and how much filtering was already setup (WP-O-Matic Wordpress plugin using the SimplePie library). This plugin does some basic encoding before insertion using Wordpress's built in post insert function which also does some filtering. I've figured out most of the filters before insertion, but now I have whacko data that I need to remove. This is an example of whacko data that I have data in one field which the content I want in the front, but this part removed which is at the end: <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:V_sGLiPBpWU" border="0"></img> <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?d=qj6IDK7rITs" border="0"></img> &lt;img src=&quot;http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:D7DqB2pKExk&quot; Notice how some of the images are escape and some aren't. I believe this has to do with the last part being cut off so as to be unrecognizable as an html tag, which then caused it to be html endcoded. Another field has only this which is now filtered before insertion, but I have to get rid of the others: &lt;img src=&quot;http://farm3.static.flickr.com/2183/2289902369_1d95bcdb85.jpg&quot; alt=&quot;post_img&quot; width=&quot;80&quot; (all examples are on one line, but broken up for readability) Question: What is the best way to work with the above escaped html (or portion of an html tag)? I can do it in Perl, PHP, SQL, Ruby, and even Python. I believe Perl to be the best at text parsing, so that's why I used the Perl tag. And PHP times out on large database operations, so that's pretty much out unless I wanted to do batch processing and what not. PS One of the nice things about using Wordpress's insert post function, is that if you use php's strip_tags function to strip out all html, insert post function will insert <p> at the paragraph points. Let me know if there's anything more that I can answer. Some article that didn't quite answer my questions. (http://stackoverflow.com/questions/2016751/remove-text-from-within-a-database-text-field) (http://stackoverflow.com/questions/462831/regular-expression-to-escape-html-ampersands-while-respecting-cdata)

    Read the article

  • Rails, Edit page update in a window

    - by Mike
    I have my code working so that I have a table of businesses. There's a pencil icon you can click on the edit the business information. The edit information comes up in a partial inside of a modal pop up box. The only problem is that once they make the changes they want and click update, it sends them to the 'show' page for that business. What I want to happen is have the pop up box close and have it update the information. This is my update function in my controller. def update @business = Business.find(params[:id]) respond_to do |format| if @business.update_attributes(params[:business]) flash[:notice] = 'Business was successfully updated.' format.html { redirect_to(business_url(@business)) } format.js else format.html { render :action => "edit" } format.xml { render :xml => @business.errors, :status => :unprocessable_entity } end end end I tried following railscast 43 and i created an .rjs file but I couldn't get that to work at all. My update was still taking me to the show page. Any help would be appreciated. EDIT: Added some more code. <% form_for(@business) do |f| %> <%= f.error_messages %> <p> <%= f.label :name %><br /> <%= f.text_field :name %> </p> ... <%= f.label :business_category %><br /> <%= f.select :business_category_id, @business_categories_map, :selected => @business.business_category_id %> </p> <p> <%= f.label :description %><br /> <%= f.text_area :description %> </p> <p> <%= f.submit 'Update' %> </p> <% end %> This is my form inside of my edit page which is being called through the index in a pop up by: <div id="popupEdit<%=h business.id %>" class="popupContact"> <a class="popupClose<%=h business.id %>" id="popupClose">x</a> <% if business.business_category_id %> <% @business = business %> <%= render "business/edit" %> <% end %> </div>

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • Calling a function that resides in the main page from a plugin?

    - by Justin Lee
    I want to call a function from within plugin, but the function is on the main page and not the plugin's .js file. EDIT I have jQuery parsing a very large XML file and building, subsequently, a large list (1.1 MB HTML file when dynamic content is copied, pasted, then saved) that has expand/collapse functionality through a plugin. The overall performance on IE is super slow and doggy, assuming since the page/DOM is so big. I am currently trying to save the collapsed content in the event.data when it is collapsed and remove it from the DOM, then bring it back when it is told to expand... the issue that I am having is that when I bring the content back, obviously the "click" and "hover" events are gone. I'm trying to re-assign them, currently doing so inside the plugin after the plugin expands the content. The issue then though is that is says the function that I declare within the .click() is not defined. Also the hover event doesn't seem to be re-assigning either.... if ($(event.data.trigger).attr('class').indexOf('collapsed') != -1 ) { // if expanding // console.log(event.data.targetContent); $(event.data.trigger).after(event.data.targetContent); $(event.data.target).hide(); /* This Line --->*/ $(event.data.target + 'a.addButton').click(addResourceToList); $(event.data.target + 'li.resource') .hover( function() { if (!($(this).attr("disabled"))) { $(this).addClass("over"); $(this).find("a").css({'display':'block'}); } }, function () { if (!($(this).attr("disabled"))) { $(this).removeClass("over"); $(this).children("a").css({'display':'none'}); } } ); $(event.data.target).css({ "height": "0px", "padding-top": "0px", "padding-bottom": "0px", "margin-top": "0px", "margin-bottom": "0px"}); $(event.data.target).show(); $(event.data.target).animate({ height: event.data.heightVal + "px", paddingTop: event.data.topPaddingVal + "px", paddingBottom: event.data.bottomPaddingVal + "px", marginTop: event.data.topMarginVal + "px", marginBottom: event.data.bottomMarginVal + "px"}, "normal");//, function(){$(this).hide();}); $(event.data.trigger).removeClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'expanded', {hoursToLive: 24 * 365}); } else if ($(event.data.trigger).attr('class').indexOf('collapsed') == -1 ) { // if collapsing $(event.data.target).animate({ height: "0px", paddingTop: "0px", paddingBottom: "0px", marginTop: "0px", marginBottom: "0px"}, "normal", function(){$(this).hide();$(this).remove();}); $(event.data.trigger).addClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'collapsed', {hoursToLive: 24 * 365}); } EDIT So, having new eyes truly makes a difference. As I was reviewing the code in this post this morning after being away over the weekend, I found where I had err'd. This: $(event.data.target + 'a.addButton').click(addResourceToList); Should be this (notice the space before a.addbutton): $(event.data.target + ' a.addButton').click(addResourceToList); Same issue with the "li.resource". So it was never pointing to the right elements... Thank you, Rene, for your help!!

    Read the article

  • MSSQL 2005: Update rows in a specified order (like ORDER BY)?

    - by JMTyler
    I want to update rows of a table in a specific order, like one would expect if including an ORDER BY clause, but MS SQL does not support the ORDER BY clause in UPDATE queries. I have checked out this question which supplied a nice solution, but my query is a bit more complicated than the one specified there. UPDATE TableA AS Parent SET Parent.ColA = Parent.ColA + (SELECT TOP 1 Child.ColA FROM TableA AS Child WHERE Child.ParentColB = Parent.ColB ORDER BY Child.Priority) ORDER BY Parent.Depth DESC; So, what I'm hoping that you'll notice is that a single table (TableA) contains a hierarchy of rows, wherein one row can be the parent or child of any other row. The rows need to be updated in order from the deepest child up to the root parent. This is because TableA.ColA must contain an up-to-date concatenation of its own current value with the values of its children (I realize this query only concats with one child, but that is for the sake of simplicity - the purpose of the example in this question does not necessitate any more verbosity), therefore the query must update from the bottom up. The solution suggested in the question I noted above is as follows: UPDATE messages SET status=10 WHERE ID in (SELECT TOP (10) Id FROM Table WHERE status=0 ORDER BY priority DESC ); The reason that I don't think I can use this solution is because I am referencing column values from the parent table inside my subquery (see WHERE Child.ParentColB = Parent.ColB), and I don't think two sibling subqueries would have access to each others' data. So far I have only determined one way to merge that suggested solution with my current problem, and I don't think it works. UPDATE TableA AS Parent SET Parent.ColA = Parent.ColA + (SELECT TOP 1 Child.ColA FROM TableA AS Child WHERE Child.ParentColB = Parent.ColB ORDER BY Child.Priority) WHERE Parent.Id IN (SELECT Id FROM TableA ORDER BY Parent.Depth DESC); The WHERE..IN subquery will not actually return a subset of the rows, it will just return the full list of IDs in the order that I want. However (I don't know for sure - please tell me if I'm wrong) I think that the WHERE..IN clause will not care about the order of IDs within the parentheses - it will just check the ID of the row it currently wants to update to see if it's in that list (which, they all are) in whatever order it is already trying to update... Which would just be a total waste of cycles, because it wouldn't change anything. So, in conclusion, I have looked around and can't seem to figure out a way to update in a specified order (and included the reason I need to update in that order, because I am sure I would otherwise get the ever-so-useful "why?" answers) and I am now hitting up Stack Overflow to see if any of you gurus out there who know more about SQL than I do (which isn't saying much) know of an efficient way to do this. It's particularly important that I only use a single query to complete this action. A long question, but I wanted to cover my bases and give you guys as much info to feed off of as possible. :) Any thoughts?

    Read the article

  • jQuery AJAX POST gives undefined index

    - by Sebastian
    My eventinfo.php is giving the following output: <br /> <b>Notice</b>: Undefined index: club in <b>/homepages/19/d361310357/htdocs/guestvibe/wp-content/themes/yasmin/guestvibe/eventinfo.php</b> on line <b>11</b><br /> [] HTML (index.php): <select name="club" class="dropdown" id="club"> <?php getClubs(); ?> </select> jQuery (index.php): <script type="text/javascript"> $(document).ready(function() { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $('#club').serialize(), success: function(data) { $('#rightbox_inside').html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>'); }, dataType: "json" }); }); $('#club').change(function(event) { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $(this).serialize(), success: function(data) { $('#rightbox_inside').hide().html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>').fadeIn('500'); }, dataType: "json" }); }); </script> I can run alerts from the jQuery, so it is active. I've copied this as is from an old version of the website, but I've changed the file structure (through to move to WordPress) so I suspect the variables might not even be reaching eventinfo.php in the first place... index.php is in wp-content/themes/cambridge and eventinfo.php is in wp-content/themes/yasmin/guestvibe but I've tried to avoid structuring issues by referencing the URL in full. Any ideas?

    Read the article

  • PHP 5.3: Late static binding doesn't work for properties when defined in parent class while missing in child class

    - by DavidPesta
    Take a look at this example, and notice the outputs indicated. <?php class Mommy { protected static $_data = "Mommy Data"; public static function init( $data ) { static::$_data = $data; } public static function showData() { echo static::$_data . "<br>"; } } class Brother extends Mommy { } class Sister extends Mommy { } Brother::init( "Brother Data" ); Sister::init( "Sister Data" ); Brother::showData(); // Outputs: Sister Data Sister::showData(); // Outputs: Sister Data ?> My understanding was that using the static keyword would refer to the child class, but apparently it magically applies to the parent class whenever it is missing from the child class. (This is kind of a dangerous behavior for PHP, more on that explained below.) I have the following two things in mind for why I want to do this: I don't want the redundancy of defining all of the properties in all of the child classes. I want properties to be defined as defaults in the parent class and I want the child class definition to be able to override these properties wherever needed. The child class needs to exclude properties whenever the defaults are intended, which is why I don't define the properties in the child classes in the above example. However, if we are wanting to override a property at runtime (via the init method), it will override it for the parent class! From that point forward, child classes initialized earlier (as in the case of Brother) unexpectedly change on you. Apparently this is a result of child classes not having their own copy of the static property whenever it isn't explicitly defined inside of the child class--but instead of throwing an error it switches behavior of static to access the parent. Therefore, is there some way that the parent class could dynamically create a property that belongs to the child class without it appearing inside of the child class definition? That way the child class could have its own copy of the static property and the static keyword can refer to it properly, and it can be written to take into account parent property defaults. Or is there some other solution, good, bad, or ugly?

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • expand div with focus-jquery

    - by Joel
    Hi guys, I'm revisiting this after a few weeks, because I could never get it to work before, and hoping to now. Please look at this website-notice the newsletter signup form at the top right. http://www.rattletree.com I am wanting it to look exactly this way for now, but when the user clicks in the box to enter their email address, the containing div will expand (or simply appear) above the email field to also include a "name" and "city" field. I'm using jquery liberally in the sight, so that is at my disposal. This form is in the header so any id info, etc can't be withing the body tag... This is what I have so far: <div class="outeremailcontainer"> <div id="emailcontainer"> <?php include('verify.php'); ?> <form action="index_success.php" method="post" id="sendEmail" class="email"> <h3 class="register2">Newsletter Signup:</h3> <ul class="forms email"> <li class="email"><label for="emailFrom">Email: </label> <input type="text" name="emailFrom" class="info" id="emailFrom" value="<?= $_POST['emailFrom']; ?>" /> <?php if(isset($emailFromError)) echo '<span class="error">'.$emailFromError.'</span>'; ?> </li> <li class="buttons email"> <button type="submit" id="submit">Send</button> <input type="hidden" name="submitted" id="submitted" value="true" /> </li> </ul> </form> <div class="clearing"> </div> </div> css: p.emailbox{ text-align:center; margin:0; } p.emailbox:first-letter { font-size: 120%; font-weight: bold; } .outeremailcontainer { height:60px; width: 275px; background-image:url(/images/feather_email2.jpg); /*background-color:#fff;*/ text-align:center; /* margin:-50px 281px 0 auto ; */ float:right; position:relative; z-index:1; } form.email{ position:relative; } #emailcontainer { margin:0; padding: 0 auto; z-index:1000; display:block; position:relative; } Thanks for any help! Joel

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Memory leaks getting sub-images from video (cvGetSubRect)

    - by dnul
    Hi, i'm trying to do video windowing that is: show all frames from a video and also some sub-image from each frame. This sub-image can change size and be taken from a different position of the original frame. So , the code i've written does basically this: cvQueryFrame to get a new image from the video Create a new IplImage (img) with sub-image dimensions ( window.height,window.width) Create a new Cvmat (mat) with sub-image dimensions ( window.height,window.width) CvGetSubRect(originalImage,mat,window) seizes the sub-image transform Mat (cvMat) to img (IplImage) using cvGetImage my problem is that for each frame i create new IplImage and cvMat which take a lot of memory and when i try to free the allocated memory I get a segmentation fault or in the case of the CvMat the allocated space does not get free (valgrind keeps telling me its definetly lost space). the following code does it: int main(void){ CvCapture* capture; CvRect window; CvMat * tmp; //window size window.x=0;window.y=0;window.height=100;window.width=100; IplImage * src=NULL,*bk=NULL,* sub=NULL; capture=cvCreateFileCapture( "somevideo.wmv"); while((src=cvQueryFrame(capture))!=NULL){ cvShowImage("common",src); //get sub-image sub=cvCreateImage(cvSize(window.height,window.width),8,3); tmp =cvCreateMat(window.height, window.width,CV_8UC1); cvGetSubRect(src, tmp , window); sub=cvGetImage(tmp, sub); cvShowImage("Window",sub); //free space if(bk!=NULL) cvReleaseImage(&bk); bk=sub; cvReleaseMat(&tmp); cvWaitKey(20); //window dimensions changes window.width++; window.height++; } } cvReleaseMat(&tmp); does not seem to have any effect on the total amount of lost memory, valgrind reports the same amount of "definetly lost" memory if i comment or uncomment this line. cvReleaseImage(&bk); produces a segmentation fault. notice i'm trying to free the previous sub-frame which i'm backing up in the bk variable. If i comment this line the program runs smoothly but with lots of memory leaks I really need to get rid of memory leaks, can anyone explain me how to correct this or even better how to correctly perform image windowing? Thank you

    Read the article

  • devise register confirmation

    - by mattherick
    hello! i have a user and an admin role in my project. i created my authentification with devise, really nice and goot tool for handling the authentification. in my admin role i don´t have any confirmation or something like that. it is really simple and doesn´t make problems. but in my user model i have following things: model: devise :database_authenticatable, :confirmable, :recoverable, :rememberable, :trackable, :validatable, :timeoutable, :registerable # Setup accessible (or protected) attributes for your model attr_accessible :email, :username, :prename, :surname, :phone, :street, :number, :location, :password, :password_confirmation and few validations, but they aren´t relevant this time. my migration looks like following one: class DeviseCreateUsers < ActiveRecord::Migration def self.up create_table(:users) do |t| t.database_authenticatable :null = false t.confirmable t.recoverable t.rememberable t.trackable t.timeoutable t.validateable t.string :username t.string :prename t.string :surname t.string :phone t.string :street t.integer :number t.string :location t.timestamps end add_index :users, :email, :unique => true add_index :users, :confirmation_token, :unique => true add_index :users, :reset_password_token, :unique => true add_index :users, :username, :unique => true add_index :users, :prename, :unique => false add_index :users, :surname, :unique => false add_index :users, :phone, :unique => false add_index :users, :street, :unique => false add_index :users, :number, :unique => false add_index :users, :location, :unique => false end def self.down drop_table :users end end into my route.rb I added following statements: map.devise_for :admins map.devise_for :users, :path_names = { :sign_up = "register", :sign_in = "login" } map.root :controller = "main" and now my problem.. if I register a new user, I fill in all my data in the register form and submit it. After that I get redirected to the controller main with the flash-notice "You have signed up successfully." And I am logged in. But I don´t want to be logged in, because I don´t have confirmed my new user account yet. If I open the console I see the last things in the logs and there I see the confirmation-mail and the text and all stuff, but I am already logged in... I can´t explain why, ... does somebody of you have an idea? If I copy out the confirmation-token from the logs and confirm my account, I can log in, but if I don´t confirm, I also can log in..

    Read the article

  • Commitment to Zend Framework - any arguments against?

    - by Pekka
    I am refurbishing a big CMS that I have been working on for quite a number of years now. The product itself is great, but some components, the Database and translation classes for example, need urgent replacing - partly self-made as far back as 2002, grown into a bit of a chaos over time, and might have trouble surviving a security audit. So, I've been looking closely at a number of frameworks (or, more exactly, component Libraries, as I do not intend to change the basic structure of the CMS) and ended up with liking Zend Framework the best. They offer a solid MVC model but don't force you into it, and they offer a lot of professional components that have obviously received a lot of attention (Did you know there are multiple plurals in Russian, and you can't translate them using a simple ($number == 0) or ($number > 1) switch? I didn't, but Zend_Translate can handle it. Just to illustrate the level of thorougness the library seems to have been built with.) I am now literally at the point of no return, starting to replace key components of the system by the Zend-made ones. I'm not really having second thoughts - and I am surely not looking to incite a flame war - but before going onward, I would like to step back for a moment and look whether there is anything speaking against tying a big system closely to Zend Framework. What I like about Zend: As far as I can see, very high quality code Extremely well documented, at least regarding introductions to how things work (Haven't had to use detailed API documentation yet) Backed by a company that has an interest in seeing the framework prosper Well received in the community, has a considerable user base Employs coding standards I like Comes with a full set of unit tests Feels to me like the right choice to make - or at least, one of the right choices - in terms of modern, professional PHP development. I have been thinking about encapsulating and abstracting ZF's functionality into own classes to be able to switch frameworks more easily, but have come to the conclusion that this would not be a good idea because: it would be an unnecessary level of abstraction it could cost performance the big advantage of using a framework - the existence of a developer base that is familiar with its components - would partly be cancelled out therefore, the commitment to ZF would be a deep one. Thus my question: Is there anything substantial speaking against committing to the Zend Framework? Do you have insider knowledge of plans of Zend Inc.'s to go evil in 2011, and make it a closed source library? Is Zend Inc. run by vampires? Are there conceptual flaws in the code base you start to notice when you've transitioned all your projects to it? Is the appearance of quality code an illusion? Does the code look good, but run terribly slow on anything below my quad-core workstation?

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • How to properly preload images, js and css files?

    - by Kenny Bones
    Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

    Read the article

< Previous Page | 155 156 157 158 159 160 161 162 163 164 165 166  | Next Page >