Search Results

Search found 14961 results on 599 pages for 'tab complete'.

Page 261/599 | < Previous Page | 257 258 259 260 261 262 263 264 265 266 267 268  | Next Page >

  • How to keep iPhone app out of iPad store?

    - by Eric
    I have an iPhone app that I have started to turn into a universal app, however the process is not complete and I want to release an update to the iPhone version. I know that you can specify device capabilities in the Info.plist file to restrict your app to certain devices, but how can I do this to prevent the unfinished universal version from appearing in the iPad store? Is checking the LSRequiresiPhoneOS BOOL entry (in the Info.plist file) enough? Thanks!

    Read the article

  • Same keyword for two purposes in java? [closed]

    - by gurukulki
    Possible Duplicates: Same keyword for two purposes in java? Same keyword for two purposes in java? As we use "default" keyword as a access specifier, and it can be used in switch statements as well with complete different purpose, So i was curious that is there any other keywords in java which can be used in more then one purposes

    Read the article

  • Firefox tabs in titlebar - can't drag maximised windows across monitors

    - by Dan
    In Windows 7, you can drag a maximised window from one monitor to the next by dragging the titlebar. However, Firefox 4 now places tabs in the title bar when it's maximised. This means that when I try and drag my Firefox window to the other monitor I end up dragging a tab instead of the whole Firefox window. It's quite annoying, as I'm used to "flicking" Windows from one monitor to the next. Does anyone know a way to stop Firefox from using the title bar for tabs?

    Read the article

  • Links opened by left-click in IE8 take forever compared to middle-mouse button

    - by Bigbio2002
    When I use the middle mouse button to open a link in a new tab, it works instantly. However, if I left-click the link to open it normally, IE8 freezes for about 5 seconds before the popup window opens. I'm sick of all the slowness and the glitchiness and the memory hogging, and I just want it to work as well as all the other browsers out there. Anybody else experiencing this and have any tips? Note: It's not the Java SSV helper or the Skype addon (because I have those disabled). I'm looking for some advanced solutions that I can try. (God, I hate IE8, but I'm a loyal Microsoft follower so I refuse to switch to Firefox. )

    Read the article

  • Need to hide displayed div when I show others

    - by adrian collins
    I am stuck. I have a page with 3 buttons, the 3 buttons do a couple things - they change the style of a div, and they also show/hide a content div. The changing of the div style works fine, but I am having issues with the content div. If you land on the page and click the "Our Brands" tab, then click the other 2 tabs, it works fine. If you land on the page, and click "What's New" or "About Us" first, then the show/hide does not work correctly - it does not until you actually click on "Our Brands." http://www.adriancollins.net/clients/kennys/ Any help would be appreciated, I am a designer first, a developer about 9000th. Show/Hide Code <script type="text/javascript"> var _hidediv = null; function showdiv(id) { if(_hidediv) _hidediv(); var div = document.getElementById(id); div.style.display = 'block'; _hidediv = function () { div.style.display = 'none'; }; } </script> Tab Divs <div id="brand_button"><a href="#" onClick="showdiv('brands_content'); lower.className='blue';angle.className='blue_angle';return false"><img src="wp-content/uploads/2012/10/brands_button.png"></a></div> <div id="whatsnew_button"><a href="#" onClick="showdiv('new_content');lower.className='black';angle.className='black_angle';return false"><img src="wp-content/uploads/2012/10/whatsnew_button.png"></a></div> <div id="about_button"><a href="#" onClick="showdiv('about_content');lower.className='green';angle.className='green_angle';return false"><img src="wp-content/uploads/2012/10/about_button.png"></a></div> Content Divs <div id="brands_content">Content...</div> <div id="whats_content">Content...</div> <div id="about_content">Content...</div> CSS #brands_content { position: relative; display: block; width: 990px; top: 10px; height: auto; min-height: 800px; margin-left: auto; margin-top: 0px; margin-right: auto; border: 0px; padding: 0px 0px 0px 0px; z-index: 12; } #new_content { position: relative; display: none; width: 990px; top: 10px; height: auto; min-height: 800px; margin-left: auto; margin-top: 0px; margin-right: auto; border: 0px; padding: 0px 0px 0px 0px; z-index: 999; color: #fff; } #about_content { position: relative; display: none; width: 990px; top: 10px; height: auto; min-height: 800px; margin-left: auto; margin-top: 0px; margin-right: auto; border: 0px; padding: 0px 0px 0px 0px; z-index: 999; } Thanks

    Read the article

  • Compare structures of two databases?

    - by streetparade
    Hello, I wanted to ask whether it is possible to compare the complete database structure of two huge databases. We have two databases, the one is a development database, the other a production database. I've sometimes forgotten to make changes in to the production database, before we released some parts of our code, which results that the production database doesn't have the same structure, so if we release something we got some errors. Is there a way to compare the two, or synchronize?

    Read the article

  • How to stop OS X from switching input method (keyboard layout) automatically?

    - by adolf garlic
    After using the wireless keyboard that comes with the iMac, I have switched to a MS Ergo Natural 4000 one. Surprisingly I had to install extra software as OS X could not work out which keyboard I had. After which I went into sys prefs and set the main input method to be "British - Microsoft" first and "Swiss German" second (what the wireless keyboard is), on the "input sources" tab: However... OS X keeps resetting my input method back to Swiss German which is driving me bananas. I have the flag thingy top right so I can see when this changes. N.B. I have "input source options" set to "use the same one in all documents" which I am assuming means keep the language the same for anything running. It also flips back on the login page. Does anyone know how to fix this?

    Read the article

  • Macvim lags while Vim on terminal is buttery smooth

    - by SaamJB
    I am running OS X Lion 10.7.3 and Macvim runs significantly slower than vim on the terminal for me. All movement commands in Macvim are much slower. Moving up and down in visual mode is equally as laggy. I see none of this lag when using vim from the terminal. Does anyone know what the reasons may be? I am running NERDtree on every open tab, and I know this contributes some memory overhead and potentially some slow down; but even when I don't run NERDtree Macvim runs much slower than vim from the terminal. Any help in solving this would be greatly appreciated.

    Read the article

  • Unique_ptr compiler errors

    - by Godric Seer
    I am designing and entity-component system for a project, and C++ memory management is giving me a few issues. I just want to make sure my design is legitimate. So to start I have an Entity class which stores a vector of Components: class Entity { private: std::vector<std::unique_ptr<Component> > components; public: Entity() { }; void AddComponent(Component* component) { this -> components.push_back(std::unique_ptr<Component>(component)); } ~Entity(); }; Which if I am not mistaken means that when the destructor is called (even the default, compiler created one), the destructor for the Entity, will call ~components, which will call ~std::unique_ptr for each element in the vector, and lead to the destruction of each Component, which is what I want. The component class has virtual methods, but the important part is its constructor: Component::Component(Entity parent) { parent.addComponent(this) // I am not sure if this would work like I expect // Other things here } As long as passing this to the method works, this also does what I want. My confusion is in the factory. What I want to do is something along the lines of: std::shared_ptr<Entity> createEntity() { std::shared_ptr<Entity> entityPtr(new Entity()); new Component(*parent); // Initialize more, and other types of Components return entityPtr; } Now, I believe that this setup will leave the ownership of the Component in the hands of its Parent Entity, which is what I want. First a small question, do I need to pass the entity into the Component constructor by reference or pointer or something? If I understand C++, it would pass by value, which means it gets copied, and the copied entity would die at the end of the constructor. The second, and main question is that code based on this sample will not compile. The complete error is too large to print here, however I think I know somewhat of what is going on. The compiler's error says I can't delete an incomplete type. My Component class has a purely virtual destructor with an implementation: inline Component::~Component() { }; at the end of the header. However since the whole point is that Component is actually an interface. I know from here that a complete type is required for unique_ptr destruction. The question is, how do I work around this? For reference I am using gcc 4.4.6.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • SQL 2008 Memory Usage

    - by Danilo Brambilla
    I have a SQL Server 2008 (ver 10.0.1600) running on a Windows Server 2008 R2 Enterprise server with 8 GB of physical ram. If I open Task Manager I can see on 'Physical Memory' section of 'Performance' tab that only 340 MB are Available of 8191 Total, but I can't see any process using such amount of memory. Please note SQL Server is memory limited to 6GB (Maximum Server Memory = 6000). If I open Sysinternals Process Explorer, I can see sqlsrvr.exe process has: Private Bytes: 227.000 K Working Set: 140.000 K Virtual Size: 8.762.000 K What does this means? Is there any way to free up this memory for other process? Why Virtual Size figure as allocated memory? I thought that Virtual Size was 'reserved memory' only.

    Read the article

  • firefox addons and their silly news tabs

    - by jettero
    Something like 30% of the addons I have in firefox update every other week and feel the need to pop open a tab about how awesome they are and all the cool things they changed. I just don't care at all and I'm very annoyed by these news tabs. When firefox opens, I want to see my home page. I've been looking for an addon to disable or kill them before I even have to look at them. Rather like addblock-for-addons. Short of finding a plugin that disables them, I'm seeking information about common interfaces so I can try to figure it out on my own. I'm wondering if I could do it in greasemonkey somehow. For example, is there something common about the url for the tabs?

    Read the article

  • Windows global shortcut hijacked by Opera

    - by Balint
    I have Chrome 37 installed as my main browser. Recently I needed to test a design in a new, Chromium based Opera version 21.0.1432.67. This later one hijacked my global shortcuts somehow, so if I press Ctrl+Shift+N to start a new session for testing, even if Chrome is running, and it is the active window, the shortcut starts a new Opera tab - even if the program is not running. It is highly annoying. Even if I uninstall Opera, I'm unable to use the aforementioned shortcut, because it will not work at all. Any hints on how to restore the original shortcut?

    Read the article

  • Exploded (unpacked) EAR vs. Packaged EAR file?

    - by Adam
    In my office we use exploded EAR's (and inside them exploded WAR directories) for our test environments, and then a packaged one for production. I've yet to find a good explanation of the reason behind this though. I understand it's easier from a deployment perspective to push out a single file during builds, but it prevents us from doing things like property file changes without doing complete rebuilds (we could skip the compiles, but our environment currently binds the compile and jar processes together). What are the major advantages / disadvantages between these two configurations?

    Read the article

  • AutoHotkey media button for the NextSong button on Pandora

    - by Christian
    I tried doing the same thing that had been advised to do on the Play/pause pandora.com with a media key answer page. I simply replaced the XXX with 119 after running GetMediaKey - instead of 122 (it was same for me), which worked just fine for its play/pause purpose. I also replaced the YY with 11 since it was the appropriate (and next) tab. It does put the small, orange, dotted square around the next song button, but instead of going to the next song, it just acts like play/pause. Is there another modification required? Using Google Chrome in Windows 7 on an Alienware m14x r2.

    Read the article

  • Viewing and deleting partitions using the BIOS?

    - by cluelesscoder
    I have an M4A785TD-M EVO Asus motherboard which uses Asus Express Gate for its motherboard (says American Megatrends, Inc at the bottom). I activate it by pressing Del; also says Tab activates BIOS Post but that doesn't seem to do anything. I went into this expecting to see a breakdown of the partitions. I have a 300GB hard-drive separated into 3 partitions. While it does show SATA for my main hard-drive and my disk drive, it doesn't show the partitions. Is this typical? Do I have to us an OS-based tool to delete the partitions or can I delete using my BIOS? I tried updating the BIOS through Asus's Update utility but it appears to be broken (connects/disconnects repeatedly). I used HWiNFO32 to get some information: BIOS Date: 06/30/10 BIOS Version: 2103 EFI BIOS: Not Capable Tried to update but it directs me to biosagentsplus.com which wants $30 for the download (another question would be how to avoid them).

    Read the article

  • Is it possible to download a .zip file into iPhone when user clicks a link inside UIWebView?

    - by Horace Ho
    In a new app, I plan to let users download their own files and stored them inside iPhone. The process is typically: iPhone present a web page by UIWebView, in which there are several links to .zip files the user browser the page and click on one of the .zip file link iPhone downloads the file into the iPhone document folder, closes WebView, acknowledges the user when download is complete How can that be done? Thanks

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • No sound through DisplayPort

    - by Chris Koknat
    I'm trying to connect my Elitebook 8440p laptop to my Samsung HDTV. The laptop does not have a HDMI connection, but it does have DisplayPort. I bought a DisplayPort-to-HDMI adapter here http://www.amazon.com/gp/product/B002CSRFD8/ref=oss_product, and connected it with a 3' HDMI cable. The video shows up fine, but there is no audio. DisplayPort, HDMI, and the adapter all support audio. I contacted HP tech support, who told me to update my sound drivers. I installed the driver and rebooted. Supposedly, I should see a "HD Audio" tab. No luck, even after installing the driver again and rebooting. HP closed the case. I'm using XP Pro.

    Read the article

  • How to apply css locally on any online page?

    - by metal-gear-solid
    For testing I don't want to upload css to FTP on each change till site complete , but site and content is online. (i'm not talking about saving page locally then apply css) Can i just apply css locally to any online page. it would be easier to edit and see changes locally till css work end. and i want to see applied effect on FF and IE. How to do that? Is it possible.

    Read the article

  • Conflict between some JavaScript and jQuery on same page

    - by hollyb
    I am using a JavaScript function and some jQuery to perform two actions on a page. The first is a simple JS function to hide/show divs and change the active state of a tab: This is the JS that show/hides divs and changes the active state on some tabs: var ids=new Array('section1','section2','section3'); function switchid(id, el){ hideallids(); showdiv(id); var li = el.parentNode.parentNode.childNodes[0]; while (li) { if (!li.tagName || li.tagName.toLowerCase() != "li") li = li.nextSibling; // skip the text node if (li) { li.className = ""; li = li.nextSibling; } } el.parentNode.className = "active"; } function hideallids(){ //loop through the array and hide each element by id for (var i=0;i<ids.length;i++){ hidediv(ids[i]); } } function hidediv(id) { //safe function to hide an element with a specified id document.getElementById(id).style.display = 'none'; } function showdiv(id) { //safe function to show an element with a specified id document.getElementById(id).style.display = 'block'; } The html: <ul> <li class="active"><a onclick="switchid('section1', this);return false;">ONE</a></li> <li><a onclick="switchid('section2', this);return false;">TWO</a></li> <li><a onclick="switchid('section3', this);return false;">THREE</a></li> </ul> <div id="section1" style="display:block;">TEST</div> <div id="section2" style="display:none;">TEST 2</div> <div id="section3" style="display:none;">TEST 3</div> Now the problem.... I've added the jQuery image gallery called galleria to one of the tabs. The gallery works great when it resides in the div that is intially set to display:block. However, when it is in one of the divs that is set to display: none; part of the gallery doesn't work when the div is toggled to be visible. Specifically, the following css ceases to be written (this is created by galleria jQuery): element.style { display:block; height:50px; margin-left:-17px; width:auto; } For the life of me, I can't figure out why the gallery fails when it's div is set to display: none. Since this declaration is overwritten when a tab is clicked (via the Javascript functions above), why would this cause a problem? As I mentioned, it works perfectly when it lives the in display: block; div. Any ideas? I don't expect anybody to be familiar with the jQuery galleria image gallery... but perhaps an idea of how one might repair this problem? Thanks!

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • Can I increase the link speed of the RAS Server on our MS Win2k3 box?

    - by Ducain
    We are running a Win2K3 Server box, and I'm a remote employee that connects via VPN. I've been frustrated for some time by the connection speed over the VPN (the office HQ has a decent speed and I have a biz class connection here), and decided to do some checking today. This morning, I was dialed in and looked at the networking tab of the task manager, and I see that the adapter for the RAS Server (the box has 4 Gigabit adapters) has a speed that seems far too low. The speed for the RAS Server link hovers between 300 - 600 Kbps. The local connection (and others) all say 1 Gbps. Can I set this to a higher speed? Is this information accurate? Thanks for the input.

    Read the article

  • Where can I find a good software implementation plan template?

    - by Corpsekicker
    This is not "programming" related as much as it is "software engineering" related. I am required to produce an implementation for additional functionality to a complete system. All I am armed with is knowledge of the existing architecture and a functional spec with visual requirements, user stories and use cases. Is there a standardised way to go about this? I suck at documentation.

    Read the article

< Previous Page | 257 258 259 260 261 262 263 264 265 266 267 268  | Next Page >