Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 28/63 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Perl : how to interrupt/resume loop by user hitting a key?

    - by Michael Mao
    Hi all: This is for debugging purpose. I've got a for loop that generates some output to Cygwin bash's CLI. I know that I can redirect outputs to text files and use Perl or even just a normal text editor to inspect the values printed out for a particular iteration, just feel that a bit painful. What I am now thinking is, to place a special subroutine inside the for loop, so that it would be "interrupted" at the beginning of each iteration, and Perl script should only resume to run after user/programmer hits a key(the Enter Key from keyboard?) In this way I can directly inspect the values printed out during each iteration. Is there a simple way to do this, without using additional libraries/CPAN ? Many thanks to the hints/suggestions in advance.

    Read the article

  • How could I evaluate this in code?

    - by WM
    There is a medieval puzzle about an old woman and a basket of eggs. On her way to market, a horseman knocks down the old woman and all the eggs are broken. The horseman will pay for the eggs, but the woman does not remember the exact number she had, only that when she took the eggs in pair, there was one left over; similarly, there was one left over when she took them three or five at a time. When she took them seven at a time, however, none were left. Write an application that can determine the smallest number of eggs the woman could have had. It might be a multiple of seven because there are no eggs left when it's seven at a time. But I have a problem. 49 eggs -1=2*24 49 eggs -1=3*16 49 eggs-4=5*9 49 eggs-0=7*7

    Read the article

  • Pseudo Transparant images

    - by Samuel
    Hello World! For an assignment at university we program in a pretty unknown language Modula 2, which lacks major graphic support. I was wondering how to achieve a 'transparency' effect on images, i figured it would work like this: Create a 2D array for the background area of the image filled with the colours of the different pixels in that area, create another 2D array of the image with again the colours of every picture and than merge the pixel colours and draw the different "new colours" on their appropriate place. What i was wondering about: how do i merge the colours (hexadecimals) just: ( colour1 + colour2 ) / 2 ? Thanks for your help!!

    Read the article

  • Accessing every child class of parent class in Java

    - by darkie15
    Hi All, I have to implement a logic whereby given a child class, I need to access its parent class and all other child class of that parent class, if any. I did not find any API in Java Reflection which allows us to access all child classes of a parent class. Is there any way to do it? Ex. class B extends class A class C extends class A Now using class B, I can find the superclass by calling getSuperClass(). But is there any way to find all the child classes once I have the parent class i.e. class B and class C?? Regards, darkie

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • Read from cin or a file

    - by m42a
    When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Adding string items to a list of type Person C#

    - by user1862808
    Im makeing a simple registration application and I have an assignment to learn more about lists. I have an assignment that says that i am to create a class called Persons and in that class set the values from the text fields in variables and add this to a list of type Person. So far: in the Person class: string strSocialSecurityNumber = string.Empty;//---( This will not be used now.) string strFirstName = string.Empty; string strLastName = string.Empty; string strFullName = string.Empty; string strAge = string.Empty; string strAll = string.Empty; int intAge = 0; List<Person> lstPerson = new List<Person>(); public void SetValues(string FirstName, string LastName, int Age) { strFirstName = FirstName; strLastName = LastName; strFullName = strFirstName + " " + strLastName; intAge = Age; strAge = Convert.ToString(intAge); strAll = strAge + " " + strFullName; } public List<Person> Person() { lstPerson.Add(strAll); return lstPerson; } Error message: "can not convert from string to Person" The assignment says that the list is to be of the type Person so i am suppose to add strings to it and ive looked how to do this but I dont know how. I have seen that there are options like "ConvertAll" But im not sure if I am allowed to use it since the list should be of type Person. Thank you!

    Read the article

  • Encapsulating user input of data for a class (C++)

    - by Dr. Monkey
    For an assignment I've made a simple C++ program that uses a superclass (Student) and two subclasses (CourseStudent and ResearchStudent) to store a list of students and print out their details, with different details shown for the two different types of students (using overriding of the display() method from Student). My question is about how the program collects input from the user of things like the student name, ID number, unit and fee information (for a course student) and research information (for research students): My implementation has the prompting for user input and the collecting of that input handled within the classes themselves. The reasoning behind this was that each class knows what kind of input it needs, so it makes sense to me to have it know how to ask for it (given an ostream through which to ask and an istream to collect the input from). My lecturer says that the prompting and input should all be handled in the main program, which seems to me somewhat messier, and would make it trickier to extend the program to handle different types of students. I am considering, as a compromise, to make a helper class that handles the prompting and collection of user input for each type of Student, which could then be called on by the main program. The advantage of this would be that the student classes don't have as much in them (so they're cleaner), but also they can be bundled with the helper classes if the input functionality is required. This also means more classes of Student could be added without having to make major changes to the main program, as long as helper classes are provided for these new classes. Also the helper class could be swapped for an alternative language version without having to make any changes to the class itself. What are the major advantages and disadvantages of the three different options for user input (fully encapsulated, helper class or in the main program)?

    Read the article

  • Find if there is an element repeating itself n/k times

    - by gleb-pendler
    You have an array size n and a constant k (whatever) You can assume the the array is of int type (although it could be of any type) Describe an algorithm that finds if there is an element(s) that repeats itself at least n/k times... if there is return one. Do so in linear time (O(n)) The catch: do this algorithm (or even pseudo-code) using constant memory and running over the array only twice

    Read the article

  • File IO, Handling CRLF

    - by aCuria
    Hi, i am writing a program that takes a file and splits it up into multiple small files of a user specified size, then join the multiple small files back again. 1) the code must work for c, c++ 2) i am compiling with multiple compilers. I am reading and writing to the files by using the stl functions fread() and fwrite() The problem I am having pertains to CRLF. If the file I am reading from contains CRLF, then I want to retain it when i split and join the files back together. If the file contains LF, then i want to retain LF. Unfortunately, fread() seems to store CRLF as \n (I think), and whatever is written by fwrite() is compiler-dependent. How do i approach this problem? Thanks.

    Read the article

  • What is the 'order' of a perceptron

    - by Martin
    A few simple marks for those who know the answer. I'm doing revision for exams at the moment and one of the past questions is: What is meant by the order of a perceptron? I can't find any information about this in my lecture notes, and even google seems at a loss. My guess is that the order is the number of layers in a neural network, but this doesn't seem quite right.

    Read the article

  • Still failing a function, not sure why...ideas on test cases to run?

    - by igor
    I've been trying to get this Sudoku game working, and I am still failing some of the individual functions. All together the game works, but when I run it through an "autograder", some test cases fail.. Currently I am stuck on the following function, placeValue, failing. I do have the output that I get vs. what the correct one should be, but am confused..what is something going on? EDIT: I do not know what input/calls they make to the function. What happens is that "invalid row" is outputted after every placeValue call, and I can't trace why.. Here is the output (mine + correct one) if it's at all helpful: http://pastebin.com/Wd3P3nDA Here is placeValue, and following is getCoords that placeValue calls.. void placeValue(Square board[BOARD_SIZE][BOARD_SIZE]) { int x,y,value; if(getCoords(x,y)) { cin>>value; if(board[x][y].permanent) { cout<< endl << "That location cannot be changed"; } else if(!(value>=1 && value<=9)) { cout << "Invalid number"<< endl; clearInput(); } else if(validMove(board, x, y, value)) { board[x][y].number=value; } } } bool getCoords(int & x, int & y) { char row; y=0; cin>>row>>y; x = static_cast<int>(toupper(row)); if (isalpha(row) && (x >= 'A' && x <= 'I') && y >= 1 && y <= 9) { x = x - 'A'; // converts x from a letter to corresponding index in matrix y = y - 1; // converts y to corresponding index in matrix return (true); } else if (!(x >= 'A' && x <= 'I')) { cout<<"Invalid row"<<endl; clearInput(); return false; } else { cout<<"Invalid column"<<endl; clearInput(); return false; } }

    Read the article

  • Java - How to declare table[i][j] elements as instance variables?

    - by JDelage
    All, I am trying to code a Connect4 game. For this, I have created a P4Game class and a P4Board class which represents the i X j dimensions of the Connect4 board. In P4Game, I have the following: public class P4Game{ //INSTANCE VARIABLES private int nbLines; private int nbColumns; private P4Board [][] position; //CONSTRUCTOR public P4Game(int nbLines, int nbColumns){ this.nbColumns = nbColumns; this.nbLines = nbLines; P4Board [][] position = new P4Board [nbLines][nbColumns]; //Creates the table to receive the instances of the P4Board object.*/ for (int i=0; i<nbLines; i++){ for (int j=0; j<nbColumns; j++){ this.position[i][j] = new P4Board(i,j); //Meant to create each object at (line=i, column=j) } } } This causes a NullPointerException in the nested loops where I mention this.position[i][j]. I reference those objects in other methods of this class so I need them to be instance variables. I suppose the exception is due to the fact that I have not listed the table element position[i][j] as an instance variable at the beginning of the class. my question to people here is (1) is my assumption correct, and if so (2) what would be the syntax to declare instance variables of this form? Thank you all for your help with what I realize is a very basic question. Hopefully it will also benefit other newbies. Cheers, JDelage

    Read the article

  • asking the container to notify your application whenever a session is about to timeout in Java

    - by user136101
    Which method(s) can be used to ask the container to notify your application whenever a session is about to timeout?(choose all that apply) A. HttpSessionListener.sessionDestroyed -- correct B. HttpSessionBindingListener.valueBound C. HttpSessionBindingListener.valueUnbound -- correct this is kind of round-about but if you have an attribute class this is a way to be informed of a timeout D. HttpSessionBindingEvent.sessionDestroyed -- no such method E. HttpSessionAttributeListener.attributeRemoved -- removing an attribute isn’t tightly associated with a session timeout F. HttpSessionActivationListener.sessionWillPassivate -- session passivation is different than timeout I agree with option A. 1) But C is doubtful How can value unbound be tightly coupled with session timeout.It is just the callback method when an attribute gets removed. 2) and if C is correct, E should also be correct. HttpSessionAttributeListener is just a class that wants to know when any type of attribute has been added, removed, or replaced in a session. It is implemented by any class. HttpSessionBindingListener exists so that the attribute itself can find out when it has been added to or removed from a session and the attribute class must implement this interface to achieve it. Any ideas…

    Read the article

  • Programming help Loop adding

    - by Deonna
    I know this probably really simple but Im not sure what im doing wrong... The assignment states: For the second program for this lab, you are to have the user enter an integer value in the range of 10 to 50. You are to verify that the user enters a value in that range, and continue to prompt him until he does give you a value in that range. After the user has successfully entered a value in that range, you are to display the sum of all the integers from 1 to the value entered. I have this so far: #include <iostream.h> int main () { int num, sum; cout << "do-while Loop Example 2" << endl << endl; do { cout << "Enter a value from 10 to 50: "; cin >> num; if (num < 10 || num > 50) cout << "Out of range; Please try again..." << endl; } while (num < 10 || num > 50); { int i; int sum = 0; for (num = 1; num <= 50; num ++) sum = sum + num; } cout << endl << "The sum is " << sum << endl; return 0; } Im just not sure exactly what i'm doing wrong... I keep getting the wrong sum for the total...

    Read the article

  • c program for this quesion

    - by sashi
    suppose that a disk drive has 5000 cylinders, numbered 0 to 4999. the drive is currently serving a request at cylinder 143 and the previous request was at cylinder 125. the ueue of pending requests in the given order is 86,1470,913,17774,948,1509,1022,1750,130. write a 'c' program for finding the total distance in cylinders that the disk arm moves to satisfy all the pending reuests from the current heads position, using SSTF scheduling algorith. seek time is the time for the disk arm to move the head to the cylider containing the desired sector. sstf algorithm selects the minimum seek time from the current head position.

    Read the article

  • Recursive QuickSort suffering a StackOverflowException -- Need fresh eyes

    - by jon
    I am working on a Recursive QuickSort method implementation in a GenericList Class. I will have a second method that accepts a compareDelegate to compare different types, but for development purposes I'm sorting a GenericList<int I am recieving stackoverflow areas in different places depending on the list size. I've been staring at and tracing through this code for hours and probably just need a fresh pair of (more experienced)eyes. Definitely wanting to learn why it is broken, not just how to fix it. public void QuickSort() { int i, j, lowPos, highPos, pivot; GenericList<T> leftList = new GenericList<T>(); GenericList<T> rightList = new GenericList<T>(); GenericList<T> tempList = new GenericList<T>(); lowPos = 1; highPos = this.Count; if (lowPos < highPos) { pivot = (lowPos + highPos) / 2; for (i = 1; i <= highPos; i++) { if (this[i].CompareTo(this[pivot]) <= 0) leftList.Add(this[i]); else rightList.Add(this[i]); } leftList.QuickSort(); rightList.QuickSort(); for(i=1;i<=leftList.Count;i++) tempList.Add(leftList[i]); for(i=1;i<=rightList.Count;i++) tempList.Add(rightList[i]); this.items = tempList.items; this.count = tempList.count; } }

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • Comparing lists in Standard ML

    - by user1050640
    I am extremely new to SML and we just got out first programming assignment for class and I need a little insight. The question is: write an ML function, called minus: int list * int list -> int list, that takes two non-decreasing integer lists and produces a non-decreasing integer list obtained by removing the elements from the first input list which are also found in the second input list. For example, minus( [1,1,1,2,2], [1,1,2,3] ) = [1,2] minus( [1,1,2,3],[1,1,1,2,2] ) = [3] Here is my attempt at answering the question. Can anyone tell me what I am doing incorrectly? I don't quite understand parsing lists. fun minus(xs,nil) = [] | minus(nil,ys) = [] | minus(x::xs,y::ys) = if x=y then minus(xs,ys) else x :: minus(x,ys); Here is a fix I just did, I think this is right now? fun minus(L1,nil) = L1 | minus(nil,L2) = [] | minus(L1,L2) = if hd(L1) > hd(L2) then minus(L1,tl(L2)) else if hd(L1) = hd(L2) then minus(tl(L1),tl(L2)) else hd(L1) :: minus(tl(L1), L2);

    Read the article

  • need help with Java solution /newbie

    - by Racket
    Hi, I'm new to programming in general so i'm trying to be as specific as possible in this question. There's this book that i'm doing some exercises on. I managed to do more than half of what they say, but it's just one input that I have been struggling to find out. I'll write the question and thereafter my code, "Write an application that creates and prints a random phone number of the form XXX-XXX-XXXX. Include the dashes in the output. Do not let the first three digits contain an 8 or 9 (but don't be more restrictive than that), and make sure that the second set of three digits is not greater than 742. Hint: Think through the easiest way to construct the phone number. Each diigit does not have to be determined separately." OK, the highlighted sentence is what i'm looking at. Here's my code: import java.util.Random; public class PP33 { public static void main (String[] args) { Random rand = new Random(); int num1, num2, num3; num1 = rand.nextInt(900) + 100; num2 = rand.nextInt(643) + 100; num3 = rand.nextInt(9000) + 1000; System.out.println(num1+"-"+num2+"-"+num3); } } How am I suppose to do this? I'm on chapter 3 so we have not yet discussed if statements etcetera, but Aliases, String class, Packages, Import declaration, Random Class, Math Class, Formatting output (decimal- & numberFormat), Printf, Enumeration & Wrapper classes + autoboxing. So consider answer the question based only on these assumptions, please. The code doesn't have any errors. Thank you!

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >