Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 28/63 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • SQL Query with computed column

    - by plotnick
    help me please with a query. Assume that we have a table with columns: Transaction StartTime EndTime Now, I need a query with computed column of (value = EndTime-Startime). Actually I need to group Users(Transaction has a FK for Users) and sort them by average time spent for transaction.

    Read the article

  • What is the 'order' of a perceptron

    - by Martin
    A few simple marks for those who know the answer. I'm doing revision for exams at the moment and one of the past questions is: What is meant by the order of a perceptron? I can't find any information about this in my lecture notes, and even google seems at a loss. My guess is that the order is the number of layers in a neural network, but this doesn't seem quite right.

    Read the article

  • Perl : how to interrupt/resume loop by user hitting a key?

    - by Michael Mao
    Hi all: This is for debugging purpose. I've got a for loop that generates some output to Cygwin bash's CLI. I know that I can redirect outputs to text files and use Perl or even just a normal text editor to inspect the values printed out for a particular iteration, just feel that a bit painful. What I am now thinking is, to place a special subroutine inside the for loop, so that it would be "interrupted" at the beginning of each iteration, and Perl script should only resume to run after user/programmer hits a key(the Enter Key from keyboard?) In this way I can directly inspect the values printed out during each iteration. Is there a simple way to do this, without using additional libraries/CPAN ? Many thanks to the hints/suggestions in advance.

    Read the article

  • mv() while reading

    - by K'
    on Linux ext3 filesystem, what happens if mv() is called on the same file (file descriptor) while reading the file? It is actually an exam question and I can only say something like: CPU traps OS for interrupt handling etc, etc. I would appreciate if OS guys out there can help me out, please :D

    Read the article

  • calling a function from another function in python

    - by user1040503
    I have written this function that takes to strings in order to see if they are anagrams: def anagram_check(str_x, str_y): x = string1.replace(" ","") y = string2.replace(" ","") lower1 = x.lower() lower2 = y.lower() sorted1 = sorted(lower1) sorted2 = sorted(lower2) if sorted1 == sorted2: return True else: return False this function works fine, the problem is that now I need to use this function in another function in order to find anagrams in a text file. I want to print a list of tuples with all the anagrams in it. this is what i have done so far def anagrams_finder(words_num): anagrams = [] f = open("words.txt") a = list(f) list1 = ([s.replace('\n', '') for s in a]) list2 = ([i.lower() for i in list1]) list3 = list2[0:words_num] #number of words from text that need to be checked. for i in list3: .... I tried using for loops, while loops, appand.... but nothing seems to work. how can I use the first function in order to help me with the second? Please help...

    Read the article

  • Read from cin or a file

    - by m42a
    When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

    Read the article

  • Calculate Age, Given Date of Birth

    - by bond
    Given a date of birth, how would I go about calculating an age in C? For example, if today's date is 20/04/2010 and the date of birth given is 12/08/86, then age will be 23 years, 8 months, and 8 days. Any suggestions would be appreciated. Thanks!

    Read the article

  • Recursive function for a binary search in C++

    - by boomsnack
    Create a recursive function for the binary search. This function accepts a sorted array and a give item being search for and returns the index of the item if this give item in the array or returns -1 if this give item is not in the array. Moreover, write a test program to test your function. Sorry for the bad english but my teacher can not write it or speak it very well. This is for a final project and determines whether I graduate or not I went to the tutor and he did not know how to do it either. Any help is greatly appreicated.

    Read the article

  • Help me find some good 'Reflection' reading materials??

    - by IbrarMumtaz
    If it wasn't you guys I would've never discovered Albahari.com's free threading ebook. My apologies if I come off as being extremely lazy but I need to make efficient use of my time and make sure am not just swallowing any garbage of the web. Therefore I am looking for the best and most informative and with a fair bit of detail for the Reflection chapter in .Net. Reflection is something that comes up time and time again and I want to extend my reading from what I know already from the official 70-536 book. I'm not a big fan of MSDN but at the moment that's al I'm using. Anyone got any other good published reading material off the inter web that can help revision for the entrance exam??? Would be greatly appreciated !!! Thanks in Advance, Ibrar

    Read the article

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

  • Strange problem with simple multithreading program in Java

    - by Elizabeth
    Hello, I am just starting play with multithreading programming. I would like to my program show alternately character '-' and '+' but it doesn't. My task is to use synchronized keyword. As far I have: class FunnyStringGenerator{ private char c; public FunnyStringGenerator(){ c = '-'; } public synchronized char next(){ if(c == '-'){ c = '+'; } else{ c = '-'; } return c; } } class ThreadToGenerateStr implements Runnable{ FunnyStringGenerator gen; public ThreadToGenerateStr(FunnyStringGenerator fsg){ gen = fsg; } @Override public void run() { for(int i = 0; i < 10; i++){ System.out.print(gen.next()); } } } public class Main{ public static void main(String[] args) throws IOException { FunnyStringGenerator FSG = new FunnyStringGenerator(); ExecutorService exec = Executors.newCachedThreadPool(); for(int i = 0; i < 20; i++){ exec.execute(new ThreadToGenerateStr(FSG)); } } } EDIT: I also testing Thread.sleep in run method instead for loop.

    Read the article

  • asking the container to notify your application whenever a session is about to timeout in Java

    - by user136101
    Which method(s) can be used to ask the container to notify your application whenever a session is about to timeout?(choose all that apply) A. HttpSessionListener.sessionDestroyed -- correct B. HttpSessionBindingListener.valueBound C. HttpSessionBindingListener.valueUnbound -- correct this is kind of round-about but if you have an attribute class this is a way to be informed of a timeout D. HttpSessionBindingEvent.sessionDestroyed -- no such method E. HttpSessionAttributeListener.attributeRemoved -- removing an attribute isn’t tightly associated with a session timeout F. HttpSessionActivationListener.sessionWillPassivate -- session passivation is different than timeout I agree with option A. 1) But C is doubtful How can value unbound be tightly coupled with session timeout.It is just the callback method when an attribute gets removed. 2) and if C is correct, E should also be correct. HttpSessionAttributeListener is just a class that wants to know when any type of attribute has been added, removed, or replaced in a session. It is implemented by any class. HttpSessionBindingListener exists so that the attribute itself can find out when it has been added to or removed from a session and the attribute class must implement this interface to achieve it. Any ideas…

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • how to demonstrate that a protocol is certain with those specifications.

    - by kawtousse
    Hi every one, we have 4 persons A, B, C and D witch want to know the averge of their salary SA SB SC SD but no one wants that the others know his salary. For that they use this protocol: A-B: [N+SA ]KB B-C:[N+SA+SB]KC C-D:[N+SA+SB+SC]KD D-A:[N+SA+SB+SC+SD]KA where the notation [m]KY represents the message x crypted xith the public key of y Is this protocol certain. can we trust it. want you please give me justification. thanks for help.

    Read the article

  • Recursive QuickSort suffering a StackOverflowException -- Need fresh eyes

    - by jon
    I am working on a Recursive QuickSort method implementation in a GenericList Class. I will have a second method that accepts a compareDelegate to compare different types, but for development purposes I'm sorting a GenericList<int I am recieving stackoverflow areas in different places depending on the list size. I've been staring at and tracing through this code for hours and probably just need a fresh pair of (more experienced)eyes. Definitely wanting to learn why it is broken, not just how to fix it. public void QuickSort() { int i, j, lowPos, highPos, pivot; GenericList<T> leftList = new GenericList<T>(); GenericList<T> rightList = new GenericList<T>(); GenericList<T> tempList = new GenericList<T>(); lowPos = 1; highPos = this.Count; if (lowPos < highPos) { pivot = (lowPos + highPos) / 2; for (i = 1; i <= highPos; i++) { if (this[i].CompareTo(this[pivot]) <= 0) leftList.Add(this[i]); else rightList.Add(this[i]); } leftList.QuickSort(); rightList.QuickSort(); for(i=1;i<=leftList.Count;i++) tempList.Add(leftList[i]); for(i=1;i<=rightList.Count;i++) tempList.Add(rightList[i]); this.items = tempList.items; this.count = tempList.count; } }

    Read the article

  • Passing an array of structs in C

    - by lelouch
    I'm having trouble passing an array of structs to a function in C. I've created the struct like this in main: int main() { struct Items { char code[10]; char description[30]; int stock; }; struct Items MyItems[10]; } I then access it like: MyItems[0].stock = 10; etc. I want to pass it to a function like so: ReadFile(MyItems); The function should read the array, and be able to edit it. Then I should be able to access the same array from other functions. I've tried heaps of declarations but none of them work. e.g. void ReadFile(struct Items[10]) I've had a look around for other questions, but the thing is they're all done different, with typedefs and asterisks. My teacher hasn't taught us pointers yet, so I'd like to do it with what I know. Any ideas? :S EDIT: Salvatore's answer is working after I fixed my prototype to: void ReadFile(struct Items[9]);

    Read the article

  • Encountering NullPointerException when trying to add polynoms

    - by Ayler Cruz
    I need to add two polynomials, which is composed of two ints. For example, the coefficient and the exponent 3x^2 would be constructed using 3 and 2 as parameters. I am getting a NullPointerException but I can't figure out why. Any help would be appreciated! public class Polynomial { private Node poly; public Polynomial() { } private Polynomial(Node p) { poly = p; } private class Term { int coefficient; int exponent; private Term(int coefficient, int exponent) { this.coefficient = coefficient; this.exponent = exponent; } } private class Node { private Term data; private Node next; private Node(Term data, Node next) { this.data = data; this.next = next; } } public void addTerm(int coeff, int exp) { Node pointer = poly; if (pointer.next == null) { poly.next = new Node(new Term(coeff, exp), null); } else { while (pointer.next != null) { if (pointer.next.data.exponent < exp) { Node temp = new Node(new Term(coeff, exp), pointer.next.next); pointer.next = temp; return; } pointer = pointer.next; } pointer.next = new Node(new Term(coeff, exp), null); } } public Polynomial polyAdd(Polynomial p) { return new Polynomial(polyAdd(this.poly, p.poly)); } private Node polyAdd(Node p1, Node p2) { if (p1 == p2) { Term adding = new Term(p1.data.coefficient + p2.data.coefficient, p1.data.exponent); p1 = p1.next; p2 = p2.next; return new Node(adding, null); } if (p1.data.exponent > p2.data.exponent) { p2 = p2.next; } if (p1.data.exponent < p2.data.exponent) { p1 = p1.next; } if (p1.next != null && p2.next != null) { return polyAdd(p1, p2); } return new Node(null, null); } }

    Read the article

  • Why is my panel not positioned correctly even after setting the boundaries?

    - by nutellafella
    I'm trying to make a simple GUI with radio buttons and I grouped them into one panel. I wanted it positioned on the leftmost side so I used the setBounds method. Whatever numbers I put on the parameters, the panel won't move. Are panels not affected by the setBounds method? Or is there another way to position my panel. Here's the snippet of my code: JPanel radioPanel = new JPanel(); radioPanel.setLayout(new GridLayout(3,1)); JRadioButton Rbutton1 = new JRadioButton("Credit Card"); JRadioButton Rbutton2 = new JRadioButton("E-Funds"); JRadioButton Rbutton3 = new JRadioButton("Check"); Rbutton3.setSelected(true); ButtonGroup Bgroup = new ButtonGroup(); Bgroup.add(Rbutton1); Bgroup.add(Rbutton2); Bgroup.add(Rbutton3); radioPanel.add(Rbutton1); radioPanel.add(Rbutton2); radioPanel.add(Rbutton3); radioPanel.setBounds(10,50,50,40); //this is where I'm trying to position the panel with the radio buttons paymentPanel.add(radioPanel); contentPane.add(paymentPanel); //contentPane is the frame contentPane.setVisible(true);

    Read the article

  • Which database I can used and relationship in it ??

    - by mimo-hamad
    My projece make me confused which I didn't find clear things that make me understand the required database and the relationships in it So, would a super one help me to solve it ?!! ;D this is required: 1) Model the data stored in the database (Identify the entities, roles, relationships, constraints, etc.) 2) Write the Oracle commands to create the database, find appropriate data, and populate the database 3) Write five different queries on your database, using the SELECT/FROM/WHERE construct provided in SQL. Your five queries should illustrate several different aspects of database querying, such as: a. Queries over more than one relation (by listing more than one relation in the FROM clause) b. Queries involving aggregate functions, such as SUM, COUNT, and AVG c. Queries involving complicated selects and joins d. Queries involving GROUP BY, HAVING or other similar functions. e. Queries that require the use of the DISTINCT keyword. And this the condition that we need to determine it to solve the required Q's above : 5) It is desired to develop an Internet membership club to buy products at special prices online. To join, new members must be referred by another existing member of the club. The system will keep the following information for each member: The member ID, referring member, birth date, member name, address, phone, mobile, credit card type, number and expiration date. The items are always shipped to the member's address noted in the membership application. The shipping fees will differ for each order.For each item to be requested, the member will select an item from a long list of possible items. For each item in the database, we store an item ID, an item name, description, and list price. The list price will be different from the actual sale price. The available quantity and the back-ordered quantity (the back-ordered quantity is the quantity on-order by the club from its suppliers) is also noted

    Read the article

  • Socket programming question

    - by dfddf
    I am given the following declaration: char inbuff[500], *ptr; int n, bufferlen; Write a program segement to receive a message having 500 bits from the TCP socket sock and store this message in inbuff. My answer is: n = recv( sock, inbuff, strlen( inbuff ), 0 ); However, I am not sure why *ptr is given in the declaration. So, I would like ask, what is the purpose of the pointer in this question?? Or my program segement is wrong? Thank you for all of yours help first!

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • I am designing a bus timetable using SQL. Each bus route has multiple stops, do I need a different t

    - by Henry
    I am trying to come up with the most efficient database as possible. My bus routes all have about 10 stops. The bus starts at number one until it reaches the 10th stop, then it comes back again. This cycle happens 3 times a day. I am really stuck as to how I can efficiently generate the times for the buses and where I should store the stops. If I put all the stops in one field and the times in another, the database won't be very dynamic. If I store all the stops one by one in a column and then the times in another column, there will be a lot of repeating happening further down as one stop has multiple times. Maybe I am missing something, I've only just started learning SQL and this is a task we have been set. Thanks in advance.

    Read the article

  • Accessing every child class of parent class in Java

    - by darkie15
    Hi All, I have to implement a logic whereby given a child class, I need to access its parent class and all other child class of that parent class, if any. I did not find any API in Java Reflection which allows us to access all child classes of a parent class. Is there any way to do it? Ex. class B extends class A class C extends class A Now using class B, I can find the superclass by calling getSuperClass(). But is there any way to find all the child classes once I have the parent class i.e. class B and class C?? Regards, darkie

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >