Search Results

Search found 2844 results on 114 pages for 'iterative conversion'.

Page 73/114 | < Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >

• How to perform spatial partitioning in n-dimensions?

  - by kevin42

  I'm trying to design an implementation of Vector Quantization as a c++ template class that can handle different types and dimensions of vectors (e.g. 16 dimension vectors of bytes, or 4d vectors of doubles, etc). I've been reading up on the algorithms, and I understand most of it: here and here I want to implement the Linde-Buzo-Gray (LBG) Algorithm, but I'm having difficulty figuring out the general algorithm for partitioning the clusters. I think I need to define a plane (hyperplane?) that splits the vectors in a cluster so there is an equal number on each side of the plane. [edit to add more info] This is an iterative process, but I think I start by finding the centroid of all the vectors, then use that centroid to define the splitting plane, get the centroid of each of the sides of the plane, continuing until I have the number of clusters needed for the VQ algorithm (iterating to optimize for less distortion along the way). The animation in the first link above shows it nicely. My questions are: What is an algorithm to find the plane once I have the centroid? How can I test a vector to see if it is on either side of that plane?

  Read the article

• Windows Batch file to echo a specific line number

  - by Lee

  So for the second part of my current dilemma, I have a list of folders in c:\file_list.txt. I need to be able to extract them (well, echo them with some mods) based on the line number because this batch script is being called by an iterative macro process. I'm passing the line number as a parameter. @echo off setlocal enabledelayedexpansion set /a counter=0 set /a %%a = "" for /f "usebackq delims=" %%a in (c:\file_list.txt) do ( if "!counter!"=="%1" goto :printme & set /a counter+=1 ) :printme echo %%a which gives me an output of %a. Doh! So, I've tried echoing !a! (result: ECHO is off.); I've tried echoing %a (result: a) I figured the easy thing to do would be to modify the head.bat code found here: http://stackoverflow.com/questions/130116/dos-batch-commands-to-read-first-line-from-text-file except rather than echoing every line - I'd just echo the last line found. Not as simple as one might think. I've noticed that my counter is staying at zero for some reason; I'm wondering if the set /a counter+=1 is doing what I think it's doing.

  Read the article

• converting a Tree to newick format. java

  - by Esmond

  I'm having problems converting a binary rooted tree to newick format. The full explanation for such a format can be found: http://code.google.com/p/mrsrf/wiki/NewickTree An example of a newick format would be as follows: for a tree T such as http://www.cs.mcgill.ca/~cs251/OldCourses/1997/topic8/images/completetreetwo.gif the newick representation would be: (((8,9),(10,11)),((12,13),(14,15))) the internal node will become the commas while the leaves will be retained. such trees have internal nodes which will always have 2 children. I have a problem using recursion to come out with this newick format. The output contains far too many nodes and braces. Any comments to resolve this problem is appreciated or even an iterative algorithm would be welcomed import java.util.Stack; public class Tree { .... public String inOrderNewick(Node root, String output) throws ItemNotFoundException { if (root.hasChild()) { output += "("; output += inOrderNewick(root.child1, output); output += ","; output += inOrderNewick(root.child2, output); output += ")"; return output; } else { output += root.getSeq(); return output; } } }

  Read the article

• dotNet Templated, Repeating, Databound ServerControl: Modifying underlying ServerControl data per te

  - by Campbeln

  I have a server control that wraps an underlying class which manages a number of indexes to track where it is in a dataset (ie: RenderedRecordCount, ErroredRecordCount, NewRecordCount, etc.). I've got the server control rendering great, but OnDataBinding I'm having an issue as to seems to happen after CreateChildControls and before Render (both of which properly manage the iteration of the underlying indexes). While I'm somewhat familiar with the ASP.NET page lifecycle, this one seems to be beyond me at the moment. So... How do I hook into the iterative process OnDataBinding uses so I can manage the underlying indexes? Will I have to iterate over the ITemplates myself, managing the indexes as I go or is there an easier solution? [edit: Agh... writing the problem out is very cathartic... I'm thinking this is exactly what I will need to do...] Also... I implemented the iteration of the underlying indexes during CreateChildControls originally in the belief that was the proper place to hook in for events like OnDataBinding (thinking it was done as the controls were being .Add'd). Now it seems that this may actually be unnecessary. So I guess the secondary question is: What happens during CreateChildControls? Are the unadulterated (read: with various <%-tags in place) controls added to the .Controls collection without any other processing?

  Read the article

• Performance question: Inverting an array of pointers in-place vs array of values

  - by Anders

  The background for asking this question is that I am solving a linearized equation system (Ax=b), where A is a matrix (typically of dimension less than 100x100) and x and b are vectors. I am using a direct method, meaning that I first invert A, then find the solution by x=A^(-1)b. This step is repated in an iterative process until convergence. The way I'm doing it now, using a matrix library (MTL4): For every iteration I copy all coeffiecients of A (values) in to the matrix object, then invert. This the easiest and safest option. Using an array of pointers instead: For my particular case, the coefficients of A happen to be updated between each iteration. These coefficients are stored in different variables (some are arrays, some are not). Would there be a potential for performance gain if I set up A as an array containing pointers to these coefficient variables, then inverting A in-place? The nice thing about the last option is that once I have set up the pointers in A before the first iteration, I would not need to copy any values between successive iterations. The values which are pointed to in A would automatically be updated between iterations. So the performance question boils down to this, as I see it: - The matrix inversion process takes roughly the same amount of time, assuming de-referencing of pointers is non-expensive. - The array of pointers does not need the extra memory for matrix A containing values. - The array of pointers option does not have to copy all NxN values of A between each iteration. - The values that are pointed to the array of pointers option are generally NOT ordered in memory. Hopefully, all values lie relatively close in memory, but *A[0][1] is generally not next to *A[0][0] etc. Any comments to this? Will the last remark affect performance negatively, thus weighing up for the positive performance effects?

  Read the article

• super light software development process

  - by Walty

  hi, For the development process I have involved so far, most have teams of SINGLE member, or occasionally two. We used python + django for the major development, the development process is actually very fast, and we do have code reviews, design pattern discussions, and constant refactoring. Though team size is small, I do think there are some development processes / best practices that could be enforced. For example, using svn would be definitely better than regular copy backup. I did read some articles & books about Agile, XP & continuous integration, I think they are nice, but still too heavy for this case (team of 1 or 2, and fast coding). For example, IMHO, with nice design pattern, and iterative development + refactoring, the TDD MIGHT be an overkill, or at least the overhead does not out-weight the advantages. And so is the pair programming. The automated testing is a nice idea, but it seems not technically feasible for every project. our current practices are: svn + milestone + code review I wonder if there are development processes / best practices specifically targeted on such super light teams? thanks.

  Read the article

• SQL Server database change workflow best practices

  - by kubi

  The Background My group has 4 SQL Server Databases: Production UAT Test Dev I work in the Dev environment. When the time comes to promote the objects I've been working on (tables, views, functions, stored procs) I make a request of my manager, who promotes to Test. After testing, she submits a request to an Admin who promotes to UAT. After successful user testing, the same Admin promotes to Production. The Problem The entire process is awkward for a few reasons. Each person must manually track their changes. If I update, add, remove any objects I need to track them so that my promotion request contains everything I've done. In theory, if I miss something testing or UAT should catch it, but this isn't certain and it's a waste of the tester's time, anyway. Lots of changes I make are iterative and done in a GUI, which means there's no record of what changes I made, only the end result (at least as far as I know). We're in the fairly early stages of building out a data mart, so the majority of the changes made, at least count-wise, are minor things: changing the data type for a column, altering the names of tables as we crystallize what they'll be used for, tweaking functions and stored procs, etc. The Question People have been doing this kind of work for decades, so I imagine there have got to be a much better way to manage the process. What I would love is if I could run a diff between two databases to see how the structure was different, use that diff to generate a change script, use that change script as my promotion request. Is this possible? If not, are there any other ways to organize this process? For the record, we're a 100% Microsoft shop, just now updating everything to SQL Server 2008, so any tools available in that package would be fair game.

  Read the article

• help me improve my sse yuv to rgb ssse3 code

  - by David McPaul

  Hello, I am looking to optimise some sse code I wrote for converting yuv to rgb (both planar and packed yuv functions). i am using SSSE3 at the moment but if there are useful functions from later sse versions thats ok. I am mainly interested in how I would work out processor stalls and the like. Anyone know of any tools that do static analysis of sse code? ; ; Copyright (C) 2009-2010 David McPaul ; ; All rights reserved. Distributed under the terms of the MIT License. ; ; A rather unoptimised set of ssse3 yuv to rgb converters ; does 8 pixels per loop ; inputer: ; reads 128 bits of yuv 8 bit data and puts ; the y values converted to 16 bit in xmm0 ; the u values converted to 16 bit and duplicated into xmm1 ; the v values converted to 16 bit and duplicated into xmm2 ; conversion: ; does the yuv to rgb conversion using 16 bit integer and the ; results are placed into the following registers as 8 bit clamped values ; r values in xmm3 ; g values in xmm4 ; b values in xmm5 ; outputer: ; writes out the rgba pixels as 8 bit values with 0 for alpha ; xmm6 used for scratch ; xmm7 used for scratch %macro cglobal 1 global _%1 %define %1 _%1 align 16 %1: %endmacro ; conversion code %macro yuv2rgbsse2 0 ; u = u - 128 ; v = v - 128 ; r = y + v + v >> 2 + v >> 3 + v >> 5 ; g = y - (u >> 2 + u >> 4 + u >> 5) - (v >> 1 + v >> 3 + v >> 4 + v >> 5) ; b = y + u + u >> 1 + u >> 2 + u >> 6 ; subtract 16 from y movdqa xmm7, [Const16] ; loads a constant using data cache (slower on first fetch but then cached) psubsw xmm0,xmm7 ; y = y - 16 ; subtract 128 from u and v movdqa xmm7, [Const128] ; loads a constant using data cache (slower on first fetch but then cached) psubsw xmm1,xmm7 ; u = u - 128 psubsw xmm2,xmm7 ; v = v - 128 ; load r,b with y movdqa xmm3,xmm0 ; r = y pshufd xmm5,xmm0, 0xE4 ; b = y ; r = y + v + v >> 2 + v >> 3 + v >> 5 paddsw xmm3, xmm2 ; add v to r movdqa xmm7, xmm1 ; move u to scratch pshufd xmm6, xmm2, 0xE4 ; move v to scratch psraw xmm6,2 ; divide v by 4 paddsw xmm3, xmm6 ; and add to r psraw xmm6,1 ; divide v by 2 paddsw xmm3, xmm6 ; and add to r psraw xmm6,2 ; divide v by 4 paddsw xmm3, xmm6 ; and add to r ; b = y + u + u >> 1 + u >> 2 + u >> 6 paddsw xmm5, xmm1 ; add u to b psraw xmm7,1 ; divide u by 2 paddsw xmm5, xmm7 ; and add to b psraw xmm7,1 ; divide u by 2 paddsw xmm5, xmm7 ; and add to b psraw xmm7,4 ; divide u by 32 paddsw xmm5, xmm7 ; and add to b ; g = y - u >> 2 - u >> 4 - u >> 5 - v >> 1 - v >> 3 - v >> 4 - v >> 5 movdqa xmm7,xmm2 ; move v to scratch pshufd xmm6,xmm1, 0xE4 ; move u to scratch movdqa xmm4,xmm0 ; g = y psraw xmm6,2 ; divide u by 4 psubsw xmm4,xmm6 ; subtract from g psraw xmm6,2 ; divide u by 4 psubsw xmm4,xmm6 ; subtract from g psraw xmm6,1 ; divide u by 2 psubsw xmm4,xmm6 ; subtract from g psraw xmm7,1 ; divide v by 2 psubsw xmm4,xmm7 ; subtract from g psraw xmm7,2 ; divide v by 4 psubsw xmm4,xmm7 ; subtract from g psraw xmm7,1 ; divide v by 2 psubsw xmm4,xmm7 ; subtract from g psraw xmm7,1 ; divide v by 2 psubsw xmm4,xmm7 ; subtract from g %endmacro ; outputer %macro rgba32sse2output 0 ; clamp values pxor xmm7,xmm7 packuswb xmm3,xmm7 ; clamp to 0,255 and pack R to 8 bit per pixel packuswb xmm4,xmm7 ; clamp to 0,255 and pack G to 8 bit per pixel packuswb xmm5,xmm7 ; clamp to 0,255 and pack B to 8 bit per pixel ; convert to bgra32 packed punpcklbw xmm5,xmm4 ; bgbgbgbgbgbgbgbg movdqa xmm0, xmm5 ; save bg values punpcklbw xmm3,xmm7 ; r0r0r0r0r0r0r0r0 punpcklwd xmm5,xmm3 ; lower half bgr0bgr0bgr0bgr0 punpckhwd xmm0,xmm3 ; upper half bgr0bgr0bgr0bgr0 ; write to output ptr movntdq [edi], xmm5 ; output first 4 pixels bypassing cache movntdq [edi+16], xmm0 ; output second 4 pixels bypassing cache %endmacro SECTION .data align=16 Const16 dw 16 dw 16 dw 16 dw 16 dw 16 dw 16 dw 16 dw 16 Const128 dw 128 dw 128 dw 128 dw 128 dw 128 dw 128 dw 128 dw 128 UMask db 0x01 db 0x80 db 0x01 db 0x80 db 0x05 db 0x80 db 0x05 db 0x80 db 0x09 db 0x80 db 0x09 db 0x80 db 0x0d db 0x80 db 0x0d db 0x80 VMask db 0x03 db 0x80 db 0x03 db 0x80 db 0x07 db 0x80 db 0x07 db 0x80 db 0x0b db 0x80 db 0x0b db 0x80 db 0x0f db 0x80 db 0x0f db 0x80 YMask db 0x00 db 0x80 db 0x02 db 0x80 db 0x04 db 0x80 db 0x06 db 0x80 db 0x08 db 0x80 db 0x0a db 0x80 db 0x0c db 0x80 db 0x0e db 0x80 ; void Convert_YUV422_RGBA32_SSSE3(void *fromPtr, void *toPtr, int width) width equ ebp+16 toPtr equ ebp+12 fromPtr equ ebp+8 ; void Convert_YUV420P_RGBA32_SSSE3(void *fromYPtr, void *fromUPtr, void *fromVPtr, void *toPtr, int width) width1 equ ebp+24 toPtr1 equ ebp+20 fromVPtr equ ebp+16 fromUPtr equ ebp+12 fromYPtr equ ebp+8 SECTION .text align=16 cglobal Convert_YUV422_RGBA32_SSSE3 ; reserve variables push ebp mov ebp, esp push edi push esi push ecx mov esi, [fromPtr] mov edi, [toPtr] mov ecx, [width] ; loop width / 8 times shr ecx,3 test ecx,ecx jng ENDLOOP REPEATLOOP: ; loop over width / 8 ; YUV422 packed inputer movdqa xmm0, [esi] ; should have yuyv yuyv yuyv yuyv pshufd xmm1, xmm0, 0xE4 ; copy to xmm1 movdqa xmm2, xmm0 ; copy to xmm2 ; extract both y giving y0y0 pshufb xmm0, [YMask] ; extract u and duplicate so each u in yuyv becomes u0u0 pshufb xmm1, [UMask] ; extract v and duplicate so each v in yuyv becomes v0v0 pshufb xmm2, [VMask] yuv2rgbsse2 rgba32sse2output ; endloop add edi,32 add esi,16 sub ecx, 1 ; apparently sub is better than dec jnz REPEATLOOP ENDLOOP: ; Cleanup pop ecx pop esi pop edi mov esp, ebp pop ebp ret cglobal Convert_YUV420P_RGBA32_SSSE3 ; reserve variables push ebp mov ebp, esp push edi push esi push ecx push eax push ebx mov esi, [fromYPtr] mov eax, [fromUPtr] mov ebx, [fromVPtr] mov edi, [toPtr1] mov ecx, [width1] ; loop width / 8 times shr ecx,3 test ecx,ecx jng ENDLOOP1 REPEATLOOP1: ; loop over width / 8 ; YUV420 Planar inputer movq xmm0, [esi] ; fetch 8 y values (8 bit) yyyyyyyy00000000 movd xmm1, [eax] ; fetch 4 u values (8 bit) uuuu000000000000 movd xmm2, [ebx] ; fetch 4 v values (8 bit) vvvv000000000000 ; extract y pxor xmm7,xmm7 ; 00000000000000000000000000000000 punpcklbw xmm0,xmm7 ; interleave xmm7 into xmm0 y0y0y0y0y0y0y0y0 ; extract u and duplicate so each becomes 0u0u punpcklbw xmm1,xmm7 ; interleave xmm7 into xmm1 u0u0u0u000000000 punpcklwd xmm1,xmm7 ; interleave again u000u000u000u000 pshuflw xmm1,xmm1, 0xA0 ; copy u values pshufhw xmm1,xmm1, 0xA0 ; to get u0u0 ; extract v punpcklbw xmm2,xmm7 ; interleave xmm7 into xmm1 v0v0v0v000000000 punpcklwd xmm2,xmm7 ; interleave again v000v000v000v000 pshuflw xmm2,xmm2, 0xA0 ; copy v values pshufhw xmm2,xmm2, 0xA0 ; to get v0v0 yuv2rgbsse2 rgba32sse2output ; endloop add edi,32 add esi,8 add eax,4 add ebx,4 sub ecx, 1 ; apparently sub is better than dec jnz REPEATLOOP1 ENDLOOP1: ; Cleanup pop ebx pop eax pop ecx pop esi pop edi mov esp, ebp pop ebp ret SECTION .note.GNU-stack noalloc noexec nowrite progbits

  Read the article

• DOS Batch file to echo a specific line number

  - by Lee

  So for the second part of my current dilemma, I have a list of folders in "c:\file_list.txt". I need to be able to extract them (well, echo them with some mods) based on the line number because this batch script is being called by an iterative macro process. I'm passing the line number as a parameter. @echo off setlocal enabledelayedexpansion set /a counter=0 set /a %%a = "" for /f "usebackq delims=" %%a in (c:\file_list.txt) do (if "!counter!"=="%1" goto :printme & set /a counter+=1) :printme echo %%a which gives me an output of "%a". Doh! So, I've tried echoing !a! (result: "ECHO is off."); I've tried echoing %a (result: a) I figured the easy thing to do would be to modify the "head.bat" code found here: http://stackoverflow.com/questions/130116/dos-batch-commands-to-read-first-line-from-text-file except rather than echoing every line - I'd just echo the last line found. Not as simple as one might think. I've noticed that my counter is staying at zero for some reason; I'm wondering if the "set /a counter+=1" is doing what I think it's doing.

  Read the article

• Tail recursion and memoization with C#

  - by Jay

  I'm writing a function that finds the full path of a directory based on a database table of entries. Each record contains a key, the directory's name, and the key of the parent directory (it's the Directory table in an MSI if you're familiar). I had an iterative solution, but it started looking a little nasty. I thought I could write an elegant tail recursive solution, but I'm not sure anymore. I'll show you my code and then explain the issues I'm facing. Dictionary<string, string> m_directoryKeyToFullPathDictionary = new Dictionary<string, string>(); ... private string ExpandDirectoryKey(Database database, string directoryKey) { // check for terminating condition string fullPath; if (m_directoryKeyToFullPathDictionary.TryGetValue(directoryKey, out fullPath)) { return fullPath; } // inductive step Record record = ExecuteQuery(database, "SELECT DefaultDir, Directory_Parent FROM Directory where Directory.Directory='{0}'", directoryKey); // null check string directoryName = record.GetString("DefaultDir"); string parentDirectoryKey = record.GetString("Directory_Parent"); return Path.Combine(ExpandDirectoryKey(database, parentDirectoryKey), directoryName); } This is how the code looked when I realized I had a problem (with some minor validation/massaging removed). I want to use memoization to short circuit whenever possible, but that requires me to make a function call to the dictionary to store the output of the recursive ExpandDirectoryKey call. I realize that I also have a Path.Combine call there, but I think that can be circumvented with a ... + Path.DirectorySeparatorChar + .... I thought about using a helper method that would memoize the directory and return the value so that I could call it like this at the end of the function above: return MemoizeHelper( m_directoryKeyToFullPathDictionary, Path.Combine(ExpandDirectoryKey(database, parentDirectoryKey)), directoryName); But I feel like that's cheating and not going to be optimized as tail recursion. Any ideas? Should I be using a completely different strategy? This doesn't need to be a super efficient algorithm at all, I'm just really curious. I'm using .NET 4.0, btw. Thanks!

  Read the article

• No idea how to solve SICP exercise 1.11

  - by Javier Badia

  This is not homework. Exercise 1.11: A function f is defined by the rule that f(n) = n if n<3 and f(n) = f(n - 1) + 2f(n - 2) + 3f(n - 3) if n 3. Write a procedure that computes f by means of a recursive process. Write a procedure that computes f by means of an iterative process. Implementing it recursively is simple enough. But I couldn't figure out how to do it iteratively. I tried comparing with the Fibonacci example given, but I didn't know how to use it as an analogy. So I gave up (shame on me) and Googled for an explanation, and I found this: (define (f n) (if (< n 3) n (f-iter 2 1 0 n))) (define (f-iter a b c count) (if (< count 3) a (f-iter (+ a (* 2 b) (* 3 c)) a b (- count 1)))) After reading it, I understand the code and how it works. But what I don't understand is the process needed to get from the recursive defintion of the function to this. I don't get how the code formed in someone's head. Could you explain the thought process needed to arrive at the solution?

  Read the article

• How to get the size of a binary tree ?

  - by Andrei Ciobanu

  I have a very simple binary tree structure, something like: struct nmbintree_s { unsigned int size; int (*cmp)(const void *e1, const void *e2); void (*destructor)(void *data); nmbintree_node *root; }; struct nmbintree_node_s { void *data; struct nmbintree_node_s *right; struct nmbintree_node_s *left; }; Sometimes i need to extract a 'tree' from another and i need to get the size to the 'extracted tree' in order to update the size of the initial 'tree' . I was thinking on two approaches: 1) Using a recursive function, something like: unsigned int nmbintree_size(struct nmbintree_node* node) { if (node==NULL) { return(0); } return( nmbintree_size(node->left) + nmbintree_size(node->right) + 1 ); } 2) A preorder / inorder / postorder traversal done in an iterative way (using stack / queue) + counting the nodes. What approach do you think is more 'memory failure proof' / performant ? Any other suggestions / tips ? NOTE: I am probably going to use this implementation in the future for small projects of mine. So I don't want to unexpectedly fail :).

  Read the article

• Building static (but complicated) lookup table using templates.

  - by MarkD

  I am currently in the process of optimizing a numerical analysis code. Within the code, there is a 200x150 element lookup table (currently a static std::vector < std::vector < double ) that is constructed at the beginning of every run. The construction of the lookup table is actually quite complex- the values in the lookup table are constructed using an iterative secant method on a complicated set of equations. Currently, for a simulation, the construction of the lookup table is 20% of the run time (run times are on the order of 25 second, lookup table construction takes 5 seconds). While 5-seconds might not seem to be a lot, when running our MC simulations, where we are running 50k+ simulations, it suddenly becomes a big chunk of time. Along with some other ideas, one thing that has been floated- can we construct this lookup table using templates at compile time? The table itself never changes. Hard-coding a large array isn't a maintainable solution (the equations that go into generating the table are constantly being tweaked), but it seems that if the table can be generated at compile time, it would give us the best of both worlds (easily maintainable, no overhead during runtime). So, I propose the following (much simplified) scenario. Lets say you wanted to generate a static array (use whatever container suits you best- 2D c array, vector of vectors, etc..) at compile time. You have a function defined- double f(int row, int col); where the return value is the entry in the table, row is the lookup table row, and col is the lookup table column. Is it possible to generate this static array at compile time using templates, and how?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Algorithm to pick values from set to match target value?

  - by CSharperWithJava

  I have a fixed array of constant integer values about 300 items long (Set A). The goal of the algorithm is to pick two numbers (X and Y) from this array that fit several criteria based on input R. Formal requirement: Pick values X and Y from set A such that the expression X*Y/(X+Y) is as close as possible to R. That's all there is to it. I need a simple algorithm that will do that. Additional info: The Set A can be ordered or stored in any way, it will be hard coded eventually. Also, with a little bit of math, it can be shown that the best Y for a given X is the closest value in Set A to the expression X*R/(X-R). Also, X and Y will always be greater than R From this, I get a simple iterative algorithm that works ok: int minX = 100000000; int minY = 100000000; foreach X in A if(X<=R) continue; else Y=X*R/(X-R) Y=FindNearestIn(A, Y);//do search to find closest useable Y value in A if( X*Y/(X+Y) < minX*minY/(minX+minY) ) then minX = X; minY = Y; end end end I'm looking for a slightly more elegant approach than this brute force method. Suggestions?

  Read the article

• Stuck in implementing Pagination in Android

  - by user443141

  I am implementing pagination for ListView in Android . I am extending the BaseAdapater class for customising the ListView. Already I have the code working fine for the Customised ListView. Below is the new requirement. 1I am fetching 6 items from server & displaying them . Now when the user scrolls to the 6th item(end of list) , I need to call the server to fetch the next 6 items & update the Listview I have overriden the methods ipublic void onScroll(AbsListView view, int firstVisibleItem,int visibleItemCount, int totalItemCount) iipublic void onScrollStateChanged(AbsListView view, int scrollState) In the first response from the server, I get the total no of pages from the server & for each time I call the server , I get the current page value . Kindly provide me the steps/sample code on how to check the last item of the list & update the list . The code should be iterative since I may need to call multiple times & fetch from server. Warm Regards, CB

  Read the article

• Highlighting a piechart slice from an HTML element (mouseover)

  - by nickhar

  I have a series of HTML table cells with data - an example of which is: <tr id="rrow1"> <td> <a href="/electricity" class="category">Electricity</a> </td> <td> 901.471 </td> </tr> <tr id="rrow2">... <tr id="rrow3">... etc In this case, each <tr> (or hypathetically for the wider community a div/span/tr/td) is assigned a sequential id based on $rrow++; in a while loop (in PHP). I also have a Piechart using the highcharts library, where i'd like to highlight the slice (sliced: true) based upon onmouseover of particular div/span/tr/td element - in this case #rrow1 as above, but multiple/iterative elements as required and (sliced: false) onmouseout... As a simple example, I've tried accessing various derivatives of the following, but failed: $('#rrow1').mouseover(function() { chart.series[0].graph.attr('sliced', true); }); $('#rrow1').mouseout(function() { chart.series[0].graph.attr('sliced', false); }); The nearest I've found is this but bastardised at most and without success: plotOptions: { series: { mouseOver: function() { if( $('#rrow1').mouseover ) series.x = sliced: true; }, mouseOut: function() { if( $('#rrow1').mouseout ) series.x = sliced: false; } } } These are far from approaching correct and despite searching I can't find a valid/helpful example to work from or draw direction. You can view the pie chart in question on jsfiddle here.

  Read the article

• Tree iterator, can you optimize this any further?

  - by Ron

  As a follow up to my original question about a small piece of this code I decided to ask a follow up to see if you can do better then what we came up with so far. The code below iterates over a binary tree (left/right = child/next ). I do believe there is room for one less conditional in here (the down boolean). The fastest answer wins! The cnt statement can be multiple statements so lets make sure this appears only once The child() and next() member functions are about 30x as slow as the hasChild() and hasNext() operations. Keep it iterative <-- dropped this requirement as the recursive solution presented was faster. This is C++ code visit order of the nodes must stay as they are in the example below. ( hit parents first then the children then the 'next' nodes). BaseNodePtr is a boost::shared_ptr as thus assignments are slow, avoid any temporary BaseNodePtr variables. Currently this code takes 5897ms to visit 62200000 nodes in a test tree, calling this function 200,000 times. void processTree (BaseNodePtr current, unsigned int & cnt ) { bool down = true; while ( true ) { if ( down ) { while (true) { cnt++; // this can/will be multiple statesments if (!current->hasChild()) break; current = current->child(); } } if ( current->hasNext() ) { down = true; current = current->next(); } else { down = false; current = current->parent(); if (!current) return; // done. } } }

  Read the article

• Matlab GUI: How to Save the Results of Functions (states of application)

  - by niko

  Hi, I would like to create an animation which enables the user to go backward and forward through the steps of simulation. An animation has to simulate the iterative process of channel decoding (a receiver receives a block of bits, performs an operation and then checks if the block corresponds to parity rules. If the block doesn't correspond the operation is performed again and the process finally ends when the code corresponds to a given rules). I have written the functions which perform the decoding process and return a m x n x i matrix where m x n is the block of data and i is the iteration index. So if it takes 3 iterations to decode the data the function returns a m x n x 3 matrix with each step is stired. In the GUI (.fig file) I put a "decode" button which runs the method for decoding and there are buttons "back" and "forward" which have to enable the user to switch between the data of recorded steps. I have stored the "decodedData" matrix and currentStep value as a global variable so by clicking "forward" and "next" buttons the indices have to change and point to appropriate step states. When I tried to debug the application the method returned the decoded data but when I tried to click "back" and "next" the decoded data appeared not to be declared. Does anyone know how is it possible to access (or store) the results of the functions in order to enable the described logic which I want to implement in Matlab GUI?

  Read the article

• How to iteratively generate k elements subsets from a set of size n in java?

  - by Bea Metitiri

  Hi, I'm working on a puzzle that involves analyzing all size k subsets and figuring out which one is optimal. I wrote a solution that works when the number of subsets is small, but it runs out of memory for larger problems. Now I'm trying to translate an iterative function written in python to java so that I can analyze each subset as it's created and get only the value that represents how optimized it is and not the entire set so that I won't run out of memory. Here is what I have so far and it doesn't seem to finish even for very small problems: public static LinkedList<LinkedList<Integer>> getSets(int k, LinkedList<Integer> set) { int N = set.size(); int maxsets = nCr(N, k); LinkedList<LinkedList<Integer>> toRet = new LinkedList<LinkedList<Integer>>(); int remains, thresh; LinkedList<Integer> newset; for (int i=0; i<maxsets; i++) { remains = k; newset = new LinkedList<Integer>(); for (int val=1; val<=N; val++) { if (remains==0) break; thresh = nCr(N-val, remains-1); if (i < thresh) { newset.add(set.get(val-1)); remains --; } else { i -= thresh; } } toRet.add(newset); } return toRet; } Can anybody help me debug this function or suggest another algorithm for iteratively generating size k subsets? EDIT: I finally got this function working, I had to create a new variable that was the same as i to do the i and thresh comparison because python handles for loop indexes differently.

  Read the article

• dotNet Templated, Repeating, Databound ServerControl: Counting the templates OnDataBind?

  - by Campbeln

  I have a server control that wraps an underlying class which manages a number of indexes to track where it is in a dataset (ie: RenderedRecordCount, ErroredRecordCount, NewRecordCount, etc.). I've got the server control rendering great, but OnDataBinding I'm having an issue as to seems to happen after CreateChildControls and before Render (both of which properly manage the iteration of the underlying indexes). While I'm somewhat familiar with the ASP.NET page lifecycle, this one seems to be beyond me at the moment. So... how do I hook into the iterative process OnDataBinding uses so I can manage the underlying indexes? Will I have to iterate over the ITemplates myself, managing the indexes as I go or is there an easier solution? Also... I implemented the iteration of the underlying indexes during CreateChildControls originally in the belief that was the proper place to hook in for events like OnDataBinding (thining it was done as the controls were being .Add'd). Now it seems that this may actually be unnecessary. So I guess the secondary question is: What happens during CreateChildControls? Are the unadulterated (read: with <%-tags in place) controls added to the .Controls collection without any other processing?

  Read the article

• Make vmware virtual machine from HDD with bad sectros

  - by mike1616

  I have a notebook with a bad HDD (it has bad sectors). I would like make a virtual disk with VMware workstation from this computer. I installed VMware Workstation & VMware vCenter Converter Standalone Client on this notebook, then I used virtualize a physical machine. It started procedure but at 38% I got this error: FAILED: An error occurred during the conversion: 'BlockLevelVolumeCloneMgr::CloneVolume: Detected a write error during the cloning of volume \WindowsBitmapDriverVolumeId=[39-06-3A-06-00-02-13-4C-1D-00-00-00]. Error: 209 (type: 1, code: 13)' I Googled it and I think it means that I have bad sectors on the HDD. How can I solve this problem and make a virtual machine from HDD with bad sectors?

  Read the article

• Natively open .doc or .odt file in LaTex

  - by MaQleod

  I have looked at ways to convert word or open office text files to LaTex format, and those have been addressed on SU here and here. These will work, but I'd rather have a native single-step solution. Does anyone know of any module or add-on for LaTex that will let one open .doc and/or .odt files without the use of third-party conversion tools? It would be ideal if it would allow for editing and saving in the same format. If it makes any difference, I am using LaTex Editor in Windows.

  Read the article

• Three ways to upload/post/convert iMovie to YouTube

  - by user44251

  For Mac users, iMovie is probably a convenient tool for making, editing their own home movies so as to upload to YouTube for sharing with more people. However, uploading iMovie files to YouTube can't be always a smooth run, I did notice many people complaining about it. This article is delivered for guiding those who are haunted by the nightmare by providing three common ways to upload iMovie files to YouTube. YouTube and iMovie YouTube is the most popular video sharing website for users to upload, share and view videos. It empowers anyone with an Internet connection the ability to upload video clips and share them with friends, family and the world. Users are invited to leave comments, pick favourites, send messages to each other and watch videos sorted into subjects and channels. YouTube accepts videos uploaded in most container formats, including WMV (Windows Media Video), 3GP (Cell Phones), AVI (Windows), MOV (Mac), MP4 (iPod/PSP), FLV (Adobe Flash), MKV (H.264). These include video codecs such as MP4, MPEG and WMV. iMovie is a common video editing software application comes with every Mac for users to edit their own home movies. It imports video footage to the Mac using either the Firewire interface on most MiniDV format digital video cameras, the USB port, or by importing the files from a hard drive where users can edit the video clips, add titles, and add music. Since 1999, eight versions of iMovie have been released by Apple, each with its own functions and characteristic, and each of them deal with videos in a way more or less different. But the most common formats handled with iMovie if specialty discarded as far as to my research are MOV, DV, HDV, MPEG-4. Three ways for successful upload iMovie files to YouTube Solution one and solution two suitable for those who are 100 certainty with their iMovie files which are fully compatible with YouTube. For smooth uploading, you are required to get a YouTube account first. Solution 1: Directly upload iMovie to YouTube Step 1: Launch iMovie, select the project you want to upload in YouTube. Step 2: Go to the file menu, click Share, select Export Movie Step 3: Specify the output file name and directory and then type the video type and video size. Solution 2: Post iMovie to YouTube straightly Step 1: Launch iMovie, choose the project you want to post in YouTube Step 2: From the Share menu, choose YouTube Step 3: In the pop-up YouTube windows, specify the name of your YouTube account, the password, choose the Category and fill in the description and tags of the project. Tick Make this movie more private on the bottom of the window, if possible, to limit those who can view the project. Click Next, and then click Publish. iMovie will automatically export and upload the movie to YouTube. Step 4: Click Tell a Friend to email friends and your family about your film. You are also allowed to copy the URL from Tell a Friend window and paste it into an email you created in your favourite email application if you like. Anyone you send to email to will be able to follow the URL directly to your movie. Note: Videos uploaded to YouTube are limited to ten minutes in length and a file size of 2GB. Solution 3: Upload to iMovie after conversion If neither of the above mentioned method works, there is still a third way to turn to. Sometimes, your iMovie files may not be recognized by YouTube due to the versions of iMovie (settings and functions may varies among versions), video itself (video format difference because of file extension, resolution, video size and length), compatibility (videos that are completely incompatible with YouTube). In this circumstance, the best and reliable method is to convert your iMovie files to YouTube accepted files, iMovie to YouTube converter will be inevitably the ideal choice. iMovie to YouTube converter is an elaborately designed tool for convert iMovie files to YouTube workable WMV, 3GP, AVI, MOV, MP4, FLV, MKV for smooth uploading with hard-to-believe conversion speed and second to none output quality. It can also convert between almost all popular popular file formats like AVI, WMV, MPG, MOV, VOB, DV, MP4, FLV, 3GP, RM, ASF, SWF, MP3, AAC, AC3, AIFF, AMR, WAV, WMA etc so as to put on various portable devices, import to video editing software or play on vast amount video players. iMovie to YouTube converter can also served as an excellent video editing tool to meet your specific program requirements. For example, you can cut your video files to a certain length, or split your video files to smaller ones and select the proper resolution suitable for demands of YouTube by Clip or Settings separately. Crop allows you to cut off unwanted black edges from your videos. Besides, you can also have a good command of the whole process or snapshot your favourite pictures from the preview window. More can be expected if you have a try.

  Read the article

• Converting text file to epub?

  - by jamesh

  I have a bunch of book length text files I'd really like to read on my EPUB reader (as it happens FBReaderJ). What would be the best route to convert them? I have access to OSX and Linux (Ubuntu). Probably happiest with a command line, but would setting for a GUI for batch conversion. My criteria for success are really based upon the shortfalls I have found with Calibre must do the whole book at least a guess of what the title/author may be. Minimum the source filename for the title. hygienic with files it uses - tidies up after itself (this is less important) doesn't try to be an all-in-one library manager (again, less important). is lenient in parsing special characters (e.g. < and & characters).

  Read the article

< Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >