Search Results

Search found 33140 results on 1326 pages for 'skip list'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 748/1326 | < Previous Page | 744 745 746 747 748 749 750 751 752 753 754 755  | Next Page >

  • Calculation error in Datasheet view in SharePoint

    - by Marius
    I have a custom list, with calculation, in SharePoint. Everything worked fine until recently when the DataSheet will show strange or wrong % calculation in a % column. But the Standard View will show correct values. IT checked the server side and everything looked ok, I checked the formulas and even re-did them in the column and the issue persist. Anyone, any suggestion? Thanks,

    Read the article

  • Variable number of arguments in ParamArray ArgList()

    - by Excel VBA guy
    If I want to pass a number of values for the ParamArray arglist via an array, how do I do it? From what I've read so far, on VBA, it appears that I need to explicitly list the values that I want to pass. But what if there are potentially different numbers of values to pass, so I do not know in advance how many I'll want to pass to the function? Is there not some way of using an array (a one-dimensional array) with a variable dimension?

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • Translating C++'s sprintf format string to C#'s string.Format

    - by thebackup
    I found the following C++ code (comments added myself): // frame_name is a char array // prefix is std::string // k is a for loop counter // frames is a std::vector string sprintf(frameName, "%s_%0*s.bmp", prefix.c_str(), k, frames[k].c_str()); I then try to translate it to C# // prefix is string // k is a for loop counter // frames is List<string> string frameName = string.Format("{0}_(what goes in here?).bmp", prefix, k, frames[k]); Basically, what would be the C# equivalent of the C++ format string "%s_%0*s.bmp"?

    Read the article

  • Changing background image of a Drupal page based on user's selection...?

    - by Sambo
    Hi I'm trying to give my users the functionality to change what the background image used on a page is. The list of background images will be a small number that won't really change. I thought I could add a few Taxonomy terms...one for each background type...then apply a class to the body tag when the page is viewed. Does this sound feasible and if so how would I go about doing it? Thanks Sam

    Read the article

  • Conditional Formating in Excel

    - by littlevahn
    HI, Im very new to Excel and VBA and was wondering I there is a way I could make conditional formatting on drop down Lists. I currently have a warning if the user enters something that is not valid (data validation) but I want to change the cell's background color to red if invalid or green if valid. Again there only options are in a List box. Any help would be awesome. Thanks

    Read the article

  • LINQ Group By to project into a non-anonymous type?

    - by vikp
    Hi, I have the following LINQ example: var colorDistribution = from product in ctx.Products group product by product.Color into productColors select new { Color = productColors.Key, Count = productColors.Count() }; All this works and makes perfect sense. What I'm trying to achieve is to group by into a strong type instead of anonymous type. For example I have a ProductColour class and I would like to Group into a List<ProductColour> Is this possible? Thank you

    Read the article

  • 404 with spring 3

    - by markjason72
    hi I am going through my first lessons with spring 3.I created a dynamic web app in eclipse with the following structure. spring3mvc \src\my.spring.HelloWorldController.java \WebContent | |-----WEB-INF\jsp\hello.jsp |-----index.jsp |-----web.xml |-----WEB-INF\spring-servlet.xml |-----WEB-INF\lib\...*.jar files I created the spring-servlet.xml as below <context:component-scan base-package="my.spring" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView" /> <property name="prefix" value="/WEB-INF/jsp/" /> <property name="suffix" value=".jsp" /> </bean> and coded the controller package my.spring; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class HelloWorldController { @RequestMapping("/hello") public ModelAndView helloWorld() { String message = "Hello World, Spring 3.0!"; return new ModelAndView("hello", "message", message); } } index.jsp has a link to hello view <html> <body> <a href="hello.html">Say Hello</a> </body> </html> finally in hello.jsp I have put <html> <body> ${message} </body> </html> My web.xml has <display-name>Spring3MVC</display-name> <welcome-file-list> <welcome-file>index.jsp</welcome-file> </welcome-file-list> <servlet> <servlet-name>spring</servlet-name> <servlet-class> org.springframework.web.servlet.DispatcherServlet </servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>spring</servlet-name> <url-pattern>*.html</url-pattern> </servlet-mapping> When I run the app on Tomcat6 server( thru eclipse),I can see the index page at http://localhost:8080/Spring3MVC/ .It displays the link to hello page.When I click on it(http://localhost:8080/Spring3MVC/hello.html),I get a 404 error. message /Spring3MVC/hello.html description The requested resource (/Spring3MVC/hello.html) is not available. Any idea how I can solve this? thanks mark.

    Read the article

  • Incoming Mails in Sharepoint

    - by frbry
    Hello all, I have a Document Library that receives a mail every week. I want to show the list of mails with their summaries. Is it possible to get that mail's content in Sharepoint, without deploying a custom code? Thanks.

    Read the article

  • JQUERY, appending an LI to a UL, and then animating that LI

    - by nobosh
    I have an UL: <ul id="news-feed">.....</ul> I'd like to be able to append a LI to the top of the list and have that appended item slideDown into place. $("#news-feed").append('<li">This is my item</li>').hide().slideDown(); Problem I'm having is the above code is sliding the news-feed item down, and not the appended item. Any ideas?

    Read the article

  • Grouping Records with the same value

    - by Ben
    I am trying to create a conversations based messaging system. I want to group all messages that have the same conversation_id so that when I display a list of current conversations you only see the latest message from each conversation. Can I group the values in the mysql query, or would I have to do it in the php?

    Read the article

  • ASP.Net 4.0 Database Created Pages

    - by Tyler
    I want to create asp.net 4.0 dynamic pages loaded from my MS SQL server. Basically, its a list of locations with informations. For example: Location1 would have the page www.site.com/location/location1.aspx Location44 would have the page www.site.com/location/location44.aspx I dont even know where to start with this, url writting maybe?

    Read the article

  • A standard event messaging system with AJAX?

    - by Gutzofter
    Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

    Read the article

  • Remove then Query fails in JPA/Hibernate (deleted entity passed to persist)

    - by Kevin
    I've got a problem with the removal of entities in my JPA application: basically, I do in this EJB Business method: load photo list ; for each photo { //UPDATE remove TagPhoto element from @OneToMany relation //DISPLAY create query involving TagPhoto ... } and this last query always throws an EntityNotFoundException (deleted entity passed to persist: [...TagPhoto#]) I think I understand the meaning of this exception, like a synchronization problem caused by my Remove, but how can I get rid of it?

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Good looking programs that are built using wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • Accessing a namespace containing .base in its name from F#

    - by emaster70
    As the title says, I'm trying to use a class declared in a namespace which contains "base" in its name. Think of a situation like the following: open Foo.base.Bar In C# I'd just use @ before base but F# seems to ignore that and to think that @ is the infix operator used for list concatenation. Since the namespace belongs to a third-party library which I cannot modify, is there a way I can still access it from F#?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 744 745 746 747 748 749 750 751 752 753 754 755  | Next Page >