Search Results

Search found 13293 results on 532 pages for 'small ticket'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 202/532 | < Previous Page | 198 199 200 201 202 203 204 205 206 207 208 209  | Next Page >

  • Free library to generate excel chart in .NET

    - by SchmerZ
    Hi to all. I need a free library (or not too expensive) for .NET to work with the excel document. I need to read data, modify, save and add charts into the document. Or in another way, I need a free library for creating and inserting charts into the excel document (only for charts). I have found FlexCel and SmartXLS, but FlexCel doesn't support the charts (can't create), while SmartXLS has a small functionality. Thanks for any help.

    Read the article

  • Run javascript function after Server-Side validation is complete.

    - by Ed Woodcock
    Ok, I've got a lightbox with a small form (2 fields) in it, inside an UpdatePanel, and I want to close this lightbox (must be done via javascript) when the 'Save' button is pressed. However, there is a need to have a server-side CustomValidator on the page, and I only want to close the lightbox if this returns as valid. Does anyone know a way to trigger javascript (or jQuery) code from a server-side validator?

    Read the article

  • Video Upload Applet

    - by Eric
    i am working on a small project that i need the ability to let users upload a video to my website or use a webcam to record a video and then upload it. i have seen this done on several sites (youtube,facebook etc) so i know that there is a java or flash applet that supports this. however i have not been able to find one. can anyone recommend a good flash or java based video uploader with these features?

    Read the article

  • Consequences of an infinite loop on Google App Engine?

    - by Axidos
    I am not a Google App Engine user. However, I understand you're billed for CPU time and other resources. What are the consequences if you happen to create an infinite loop? Will Google ever terminate it, or will you have to do it yourself manually somehow? I'm a hobbyist developer worried about a small error that might end up costing hundreds.

    Read the article

  • Git is slow on startup

    - by Daniel Mahadi
    Hi, I have a small problem with git in my pc, I create a new folder and i start Git Bash, but it takes so long for it load git, as in it will show the command prompt but it need a while for the git line to show up. Any clue on this? Thanks

    Read the article

  • iPhone team dev, do we all need the same OS?

    - by aruwanwan
    I´m just starting iPhone development with a small team of (really young and naive) colleagues, we all are fairly new to OS X, my question is: If we are planning to develop for every iPod Touch/iPhone out there (not the iPad, I read that thing requires Snow Leopard), what problems will we encounter when sharing code (and making commits) if we all have a combination of Leopard and Snow Leopard systems?

    Read the article

  • Why won't the following haskell code compile?

    - by voxcogitatio
    I'm in the process of writing a small lisp interpreter in haskell. In the process i defined this datatype, to get a less typed number; data Number = _Int Integer | _Rational Rational | _Float Double deriving(Eq,Show) Compiling this fails with the following error: ERROR "types.hs":16 - Syntax error in data type declaration (unexpected `|') Line 16 is the line w. the first '|' in the code above.

    Read the article

  • Images are not appeared in Firefox

    - by moon
    I create small web app and it works in IE but I tried in firefox many css layouts are unavailable and images are not appeared.To appear image and to work in both browsers,how can I handle.Please tell me the way .Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • are the A+ and MCSE courses worthwhile

    - by billy
    I'm new to this field and would like to acquire the knowledge necessary to work for myself, troubleshooting, repairs, setting up and maintaining networks for small businesses etc. Are the A+ and MCSE courses worth doing? I'm more interested in knowledge than certificates.

    Read the article

  • Grammar/own-written parser?

    - by wvd
    Hello all, I'm doing some small projects which involve having different syntaxis for something, however sometimes these syntaxis are so easy that using a parser generator might be overkill. Now, when should I use a own-made parser, and when should I use a parser generator? Thanks, William van Doorn

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • App Engine Django Form Uniqueness Validation?

    - by GeekTantra
    Is there a simpler way to use uniqueness validation with Django Forms in AppEngine? I understand that performance would be problem if we keep an uniqueness constraint but since the amount of data being added is very small performance is not a big concern, rather development time is a concern here. Any help is appreciated.

    Read the article

  • Shopping Cart Suggestions Needed

    - by Maen
    I am building a small web app for a pharmacy to keep track of sales and stocks, so in short, in one page, the pharmacist will enter a bar-code and the item is displayed, pharmacist enters quantity (price will be automatically calculated) then next item and next and so on, I haven't worked with such a problem before so I would appreciate any advices/tips on how to do it, what to use and wither its already done in some tidy neat way I can just import into my page. Am using ASP.net and VB.net, SQL 2008 and all express withing Visual Web Developer (also ExpresS)

    Read the article

  • Tracking down data load performance issues in SSIS package

    - by SteveC
    Are there any ways to determine what the differences in databases are that affect a SSIS package load performance ? I've got a package which loads and does various bits of processing on ~100k records on my laptop database in about 5 minutes Try the same package and same data on the test server, which is a reasonable box in both CPU and memory, and it's still running ... about 1 hour so far :-( Checked the package with a small set of data, and it ran through Ok

    Read the article

  • How can I multiply each item in an array easily with PHP?

    - by Henry
    I have an array called $times. It is a list of small numbers (15,14,11,9,3,2). These will be user submitted and are supposed to be minutes. As PHP time works on seconds, I would like to multiply each element of my array by 60. I've been playing around with array_walk and array_map but I can't get those working :S Thanks.

    Read the article

  • Using $this when not in object context

    - by Ken
    I'm creating a function to show blog's. So I made a show blog function but it keeps giving "Using $this when not in object context" error Class Blog{ public function getLatestBlogsBig($cat = null){ $sqlString = "SELECT blog_id FROM jab_blog"; if($cat != null) $sqlString .= " WHERE blog_cat = " . $cat; $sqlString .= " ORDER BY blog_id DESC LIMIT 5"; $blog = mysql_query($sqlString); while($id = mysql_result($blog,"blog_id")){ $this->showBlog($id); //Error is on this line } } function showBlog($id,$small = false){ $sqlString = "SELECT blog_id FROM jab_blog WHERE blog_id=" . $id . ";"; $blog = mysql_query($sqlString); if($small = true){ echo "<ul>"; while($blogItem = mysql_fetch_array($blog)){ echo '<a href="' . $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']) .'">' . $blogItem['blog_title'] . '</a></li>'; } echo "</ul>"; }else{ while($blogItem = mysql_fetch_array($blog)){ ?> <div class="post"> <h2 class="title"><a href="<?php echo $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']);?>"><?php echo $blogItem['blog_title'];?></a></h2> <p class="meta"><span class="date">The date implement</span><span class="posted">Posted by <a href="#">Someone</a></span></p> <div style="clear: both;">&nbsp;</div> <div class="entry"> <?php echo $blogItem['blog_content'];?> </div> </div> <?php } } } }

    Read the article

  • Why is a c++ reference considered safer than a pointer?

    - by anand.arumug
    When the c++ compiler generates very similar assembler code for a reference and pointer, why is using references preferred (and considered safer) compared to pointers? I did see Difference between pointer variable and reference variable in C++ which discusses the differences between them. EDIT-1: I was looking at the assembler code generated by g++ for this small program: int main(int argc, char* argv[]) { int a; int &ra = a; int *pa = &a; }

    Read the article

  • Bash: easy way to put a configurable load on a system?

    - by WizardOfOdds
    In order to test how a program reacts when system resources become scarce (mainly the CPU but I'm interested in disk I/O too), I'd like to put an arbitrary load on the system. Currently I'm doing something like this: #!/bin/bash while true do echo "a" >> a.txt md5 a.txt done I could also start mp3-encoding audio files, or whatever. What would be an easy and small Bash script that could be used to simulate an arbitrary load, ideally configurable using parameter(s)?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 198 199 200 201 202 203 204 205 206 207 208 209  | Next Page >